ID: 1065006863

View in Genome Browser
Species Human (GRCh38)
Location 10:21388182-21388204
Sequence ACAGCTACAAATACCTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065006863_1065006867 26 Left 1065006863 10:21388182-21388204 CCCTGGAAGGTATTTGTAGCTGT No data
Right 1065006867 10:21388231-21388253 GTGCACAGTAAATTGGATCTAGG No data
1065006863_1065006865 -9 Left 1065006863 10:21388182-21388204 CCCTGGAAGGTATTTGTAGCTGT No data
Right 1065006865 10:21388196-21388218 TGTAGCTGTTATATAGAAAATGG No data
1065006863_1065006866 19 Left 1065006863 10:21388182-21388204 CCCTGGAAGGTATTTGTAGCTGT No data
Right 1065006866 10:21388224-21388246 ACATTCAGTGCACAGTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065006863 Original CRISPR ACAGCTACAAATACCTTCCA GGG (reversed) Intergenic
No off target data available for this crispr