ID: 1065009303

View in Genome Browser
Species Human (GRCh38)
Location 10:21407163-21407185
Sequence TGGAGTTTAAGCCTCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065009303_1065009307 2 Left 1065009303 10:21407163-21407185 CCTCCTGTGAGGCTTAAACTCCA No data
Right 1065009307 10:21407188-21407210 GGAAAAATTCTATAAGTTGTAGG No data
1065009303_1065009308 3 Left 1065009303 10:21407163-21407185 CCTCCTGTGAGGCTTAAACTCCA No data
Right 1065009308 10:21407189-21407211 GAAAAATTCTATAAGTTGTAGGG No data
1065009303_1065009309 4 Left 1065009303 10:21407163-21407185 CCTCCTGTGAGGCTTAAACTCCA No data
Right 1065009309 10:21407190-21407212 AAAAATTCTATAAGTTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065009303 Original CRISPR TGGAGTTTAAGCCTCACAGG AGG (reversed) Intergenic
No off target data available for this crispr