ID: 1065011781

View in Genome Browser
Species Human (GRCh38)
Location 10:21427504-21427526
Sequence ATTTATGGTGGCGAGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065011776_1065011781 22 Left 1065011776 10:21427459-21427481 CCAAAAGGCAACTTTTTGGGCAC 0: 16
1: 35
2: 63
3: 97
4: 154
Right 1065011781 10:21427504-21427526 ATTTATGGTGGCGAGTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065011781 Original CRISPR ATTTATGGTGGCGAGTATCC AGG Intergenic
No off target data available for this crispr