ID: 1065016624

View in Genome Browser
Species Human (GRCh38)
Location 10:21468297-21468319
Sequence CTCTCCTAACAAGTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065016616_1065016624 8 Left 1065016616 10:21468266-21468288 CCCGTAGTCTAGACCCAGTCTCT No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data
1065016620_1065016624 -6 Left 1065016620 10:21468280-21468302 CCAGTCTCTAGGAAGTCCTCTCC No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data
1065016619_1065016624 -5 Left 1065016619 10:21468279-21468301 CCCAGTCTCTAGGAAGTCCTCTC No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data
1065016617_1065016624 7 Left 1065016617 10:21468267-21468289 CCGTAGTCTAGACCCAGTCTCTA No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data
1065016615_1065016624 9 Left 1065016615 10:21468265-21468287 CCCCGTAGTCTAGACCCAGTCTC No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data
1065016614_1065016624 30 Left 1065016614 10:21468244-21468266 CCACTGTAGACTAGGTGCTCGCC No data
Right 1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065016624 Original CRISPR CTCTCCTAACAAGTGGAGCA GGG Intergenic
No off target data available for this crispr