ID: 1065025274

View in Genome Browser
Species Human (GRCh38)
Location 10:21534740-21534762
Sequence AGGCTGGGCCGAGAACCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065025268_1065025274 28 Left 1065025268 10:21534689-21534711 CCATAGTATGAAGGAGATGATTG 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG 0: 1
1: 1
2: 0
3: 13
4: 119
1065025267_1065025274 29 Left 1065025267 10:21534688-21534710 CCCATAGTATGAAGGAGATGATT 0: 1
1: 0
2: 0
3: 13
4: 132
Right 1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG 0: 1
1: 1
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065025274 Original CRISPR AGGCTGGGCCGAGAACCCGC TGG Exonic
900498928 1:2990157-2990179 AGGCCTGGCAGAGAACCCGGAGG - Intergenic
901065690 1:6493150-6493172 AGGGTGGGCCCAGAAGCCGAAGG + Intronic
901835226 1:11919800-11919822 AGGCTGGGCCGGGGCCCCCCAGG - Exonic
903173790 1:21569078-21569100 AGGCTGGGCCAAGAACGAGGTGG + Intronic
903653806 1:24936703-24936725 TGGCTGGGCCCAGAAGCTGCTGG - Intronic
904914364 1:33959446-33959468 CTGCTGGGGCGAGAACACGCAGG - Intronic
915463587 1:156083063-156083085 AGGCTGGGGCTGGAACCCCCTGG + Intronic
916788672 1:168105370-168105392 AGGGTGGGCCCTGAACCAGCAGG + Intronic
919892019 1:201982623-201982645 CGGCCGGGCCGCGAACCCGAGGG - Exonic
922775430 1:228212332-228212354 GGTCCGCGCCGAGAACCCGCTGG + Exonic
923680361 1:236113773-236113795 AGGCAGGGCCGTGCACCCTCTGG + Intergenic
924817444 1:247455011-247455033 AGGCTAGGCTGTGAACACGCAGG + Intergenic
924835123 1:247639680-247639702 AGGCTGGGACGAGGCCGCGCGGG + Intergenic
1065025274 10:21534740-21534762 AGGCTGGGCCGAGAACCCGCTGG + Exonic
1065550009 10:26860696-26860718 TGGCCGGGTCGAGGACCCGCCGG - Intronic
1070290148 10:75108663-75108685 AGGCTGGGCCCAGAAACAGGGGG + Intronic
1071398321 10:85244870-85244892 AGACTGTGCAGAGAACCTGCGGG - Intergenic
1072212616 10:93260363-93260385 AGGCTGAGGCGTGAACCCGGAGG + Intergenic
1076481222 10:130786481-130786503 CGGCTGGGCAGGGAACCCGAAGG + Intergenic
1077192516 11:1261327-1261349 TGGCTGGGCAGAGAAACGGCGGG + Intronic
1077400995 11:2357353-2357375 AGGATGGGCTGGGTACCCGCTGG - Intergenic
1077476165 11:2791568-2791590 CGGCTGGGCTGGGAAACCGCGGG + Intronic
1078469473 11:11575498-11575520 GGCCTGGGCCCAGAACCTGCAGG - Intronic
1081683758 11:45027081-45027103 AGGCTGGGCCGTGTGCCCCCTGG - Intergenic
1091991576 12:4960255-4960277 ATGCTGGGCTGGGAACCCGAGGG - Intergenic
1100201497 12:92303592-92303614 AGGCAGGGCAGAGAACACCCTGG - Intergenic
1102101176 12:110280605-110280627 CGTCAGGGCCCAGAACCCGCTGG + Intergenic
1103034272 12:117643721-117643743 AGGCTGGGCCCAGAATCGGGGGG - Intronic
1103749876 12:123151188-123151210 GGGCCGGGCCGAGACTCCGCAGG - Intergenic
1103927753 12:124433181-124433203 AGGCTGTGCCAGGAACGCGCTGG + Intronic
1113531327 13:111029684-111029706 AGGATGGTCCGTGAACACGCAGG + Intergenic
1113707853 13:112445778-112445800 AAGCTGGGCTGGGGACCCGCAGG + Intergenic
1121266142 14:92603837-92603859 GGGCTGGGCCTGGAACCAGCGGG + Intronic
1122799167 14:104221264-104221286 AGGATGGGCCGAGAGCCAGCAGG - Intergenic
1132615595 16:839870-839892 AGGCAGCGCCGAAAACCAGCTGG - Intergenic
1133038125 16:3046116-3046138 AGGGCGGGCCGGGACCCCGCGGG + Intergenic
1133322835 16:4924940-4924962 AGGCTGGGCTGTGAGCCAGCAGG - Intronic
1136777257 16:32878601-32878623 AGGCGGGGCCTAGGACCAGCTGG + Intergenic
1136893366 16:33982912-33982934 AGGCGGGGCCTAGGACCAGCTGG - Intergenic
1137675246 16:50300877-50300899 AGGCTGGGCTGGGTAGCCGCAGG + Intronic
1141811777 16:86380804-86380826 TGGCTGGGCCGAGAAGCATCTGG + Intergenic
1203079671 16_KI270728v1_random:1140710-1140732 AGGCGGGGCCTAGGACCAGCTGG + Intergenic
1144632265 17:16880299-16880321 AGGCAGGGCCGCGAAGCCTCCGG + Intergenic
1145963718 17:28902535-28902557 ACGGTGAGCCGAGAACCCGCCGG - Intronic
1146100055 17:29972552-29972574 AGGCATGGCCCAGAGCCCGCGGG - Intronic
1147184413 17:38705677-38705699 GGGCTGGGCCGAGAACCCGCTGG + Exonic
1147302136 17:39538046-39538068 AGGATGGGCCAAGAACCCCTAGG + Intronic
1147377659 17:40032538-40032560 AGGCTGGGCCCAGTGCCCGCAGG + Intronic
1152254730 17:79231288-79231310 AGGTTGAGGCGAGAACCCCCTGG + Intronic
1154173627 18:12067843-12067865 AGGGTGGGCCGGGGACCCCCTGG + Intergenic
1158946420 18:62450894-62450916 AGGCTGGGCCGGCATCCCGGAGG + Intergenic
1160067457 18:75589064-75589086 AGGCTGGGCCGAGGTTCCGGGGG + Intergenic
1160190145 18:76708710-76708732 AGGCTGCTCCGGGAAGCCGCAGG + Intergenic
1160754853 19:751744-751766 ACGCTGGGCCGAGTCCCTGCTGG - Intronic
1161072731 19:2270634-2270656 AAGCTCGACCGAGACCCCGCGGG - Intronic
1161346135 19:3769699-3769721 TCGCGGGGCCGAGAACCCGCTGG - Exonic
1161393541 19:4033255-4033277 TGGCTGGGCCGTGAGCCTGCGGG + Intronic
1162242076 19:9363168-9363190 AGGCTGGGGCGGGAAGCTGCAGG - Intronic
1162479720 19:10921246-10921268 AGCCTCGGCCGAGAGCCCCCAGG - Intronic
1162778771 19:12995958-12995980 AGGGGGGGCCGAGAGCCCGCGGG + Intronic
1162935528 19:13979796-13979818 AAGCTGTGCCAAGAACCCGCAGG + Intronic
1162951145 19:14072748-14072770 AGGCGGGTCAGAGAAGCCGCCGG + Intronic
1163685551 19:18709943-18709965 TGGGTGGGACGAGAAGCCGCTGG - Intronic
1163753986 19:19095782-19095804 ACGCTGGCCCCACAACCCGCTGG + Intronic
1164613575 19:29650504-29650526 AGGCTGGGCCCTGAACACCCTGG - Intergenic
1164748213 19:30631362-30631384 TGGCTGAGCCGAGATCCTGCAGG + Intronic
1165444972 19:35851617-35851639 AGGCAGGGCCCAGAAGCCCCGGG + Exonic
1168523609 19:57071536-57071558 AGGCTGGGATCTGAACCCGCAGG + Intergenic
925442548 2:3900840-3900862 AAGCAGGGCAGAGGACCCGCTGG + Intergenic
929460733 2:42100902-42100924 AGGCTGGGCCTAGAACACTGAGG + Intergenic
932331680 2:70901472-70901494 AGGCGGCGCCGAGAGCCGGCTGG - Intronic
933613290 2:84459120-84459142 CGGCGGGGCCAATAACCCGCGGG + Intronic
935249849 2:101251943-101251965 AGTCTGGGCTGAGAACCACCAGG - Intronic
946226100 2:218264879-218264901 GGGCTGGGCTGTGAACCCTCAGG + Intronic
947843891 2:233228308-233228330 AGGCTCACCCGAGAACCCTCTGG - Intronic
949035496 2:241814151-241814173 AGGCTGGCCAGAGAGCCCCCGGG - Intronic
1169033437 20:2430887-2430909 TGGCTGGGCCCAGAACCTGAAGG - Exonic
1169806810 20:9568070-9568092 AAGATGGGCCGAGAAGCTGCCGG + Intronic
1170004167 20:11647121-11647143 AAGCTGGGCCCATAACCCTCAGG - Intergenic
1175889448 20:62309861-62309883 AGGCTGGGCTGAGGACCACCTGG - Intronic
1178453755 21:32728128-32728150 CGGCTGGGCCTGGCACCCGCGGG + Intergenic
1180870567 22:19144463-19144485 AGGATGGGCCCAGAAGTCGCCGG + Intronic
1181775246 22:25154589-25154611 AGGCTGGGCTGAGCACCAGAAGG + Intronic
1183671601 22:39276157-39276179 GGGCTGGGCAGACAACACGCAGG - Intergenic
1184756202 22:46517258-46517280 ATGCTGGGCCGATGACCCGCAGG + Intronic
1185090014 22:48761127-48761149 TGGCTGGGCCGGGAACTGGCTGG - Intronic
1185322078 22:50206101-50206123 AGGCTGTGCCGACAACCTGCTGG + Intronic
1185386223 22:50532319-50532341 AGGCAGGGACGTGAACTCGCGGG + Intronic
969657674 4:8507505-8507527 AGGATGGTCCCAGAACCCACAGG - Intergenic
970272759 4:14364968-14364990 AGGCTGGGCCTAGAGTCCCCTGG - Intergenic
972756315 4:42051044-42051066 AATCTGGGCAGAGAACCAGCAGG + Intronic
976808266 4:89072555-89072577 AGGCTGGGCAGAGGCACCGCAGG + Intronic
982198545 4:152937837-152937859 CGGCTGGGCCGCGAATCCCCGGG - Intronic
985548964 5:523835-523857 AGGCGGGGCGGAGACCCCACAGG + Intronic
985629932 5:1008981-1009003 AGCCGGGGCCGGGAGCCCGCGGG - Exonic
985648319 5:1095524-1095546 AGGATGGGCCGAGCACCCCTAGG - Intronic
985830558 5:2225248-2225270 AGGCTGAACCCAGACCCCGCAGG + Intergenic
989582157 5:43043101-43043123 AGGCGCGGCGGAGAAACCGCAGG + Exonic
992663565 5:78984785-78984807 AGGTTGGGGCGAGAAGCCGCCGG + Intronic
997382236 5:133446144-133446166 AGCCTGGCCCGAGAGCCTGCAGG - Intronic
1001758113 5:174186283-174186305 AGGCTGCCCCGAGGACCCCCCGG + Intronic
1002639649 5:180624727-180624749 AGGCTGGGCAGAGATGCCTCCGG - Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1015024606 6:128519347-128519369 CGGCTTGACCGAGAACCCCCAGG + Intronic
1015999521 6:139029019-139029041 CGGCTGGGCCGAGACCTCGCGGG + Intronic
1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG + Intergenic
1019194862 6:170275188-170275210 AGGCTGTGCGGAGAAGCCGCTGG + Intergenic
1019479678 7:1260672-1260694 AGGCCAGGCCGGGCACCCGCAGG - Intergenic
1019664728 7:2246125-2246147 GGGCTGGGCAGAGAACCCCCGGG - Intronic
1022502862 7:30893478-30893500 AGGCTGTGCCGAGGCCCCGGTGG + Intergenic
1024506604 7:50167437-50167459 AGGCTGGGCCATGCACCCACGGG - Intergenic
1032321655 7:130891338-130891360 GGGCTGGGCCCAGAACCCAGAGG + Intergenic
1035530103 8:344700-344722 AGGCTGGGCAGAGAACGAGCAGG - Intergenic
1049513488 8:143041875-143041897 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049513501 8:143041925-143041947 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049513514 8:143041975-143041997 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049513527 8:143042025-143042047 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049513540 8:143042075-143042097 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049513552 8:143042125-143042147 GGGCTGGGCTGAGAACGCCCTGG - Intronic
1049583629 8:143423345-143423367 AGGCTCAGCCAAGACCCCGCAGG + Intronic
1049687925 8:143946409-143946431 AGGCTGCTCCGAGAGCCGGCAGG + Intronic
1049802228 8:144523167-144523189 AGGCTTGGCAGGCAACCCGCAGG + Exonic
1057212381 9:93207128-93207150 AGGCTGAGGCCAGAACCCTCAGG + Intronic
1059435932 9:114276216-114276238 AGGCTGGGCCATGAGCCCTCAGG + Intronic
1061485823 9:130920036-130920058 TGGCTGTGCCCAGAACCTGCAGG - Intronic
1061515534 9:131087832-131087854 AGGCTGGGCCCTGAACCCCTGGG + Intronic
1061894740 9:133641359-133641381 AGGGTGAGCAGAGAACCCTCTGG + Intronic
1185734204 X:2485163-2485185 AGGCTGGGATGAGAACCGTCGGG + Intronic
1186355435 X:8784452-8784474 GCGCCGGGCCGAGCACCCGCGGG + Intergenic
1190165769 X:48071721-48071743 AGGCTGGACAGAGCACCCCCCGG + Intergenic
1190708432 X:53048989-53049011 AGGCTTGGCAGAGGCCCCGCGGG + Intergenic
1191197525 X:57740881-57740903 AGGCTGGCCCTAGAAGCCTCAGG - Intergenic
1191595214 X:62936163-62936185 AGGTTGGGCAGAGAACTTGCTGG - Intergenic
1199556426 X:149114137-149114159 AGGCTGGGTCCAGCACCTGCTGG - Intergenic