ID: 1065025305

View in Genome Browser
Species Human (GRCh38)
Location 10:21534863-21534885
Sequence CCCACCTGGGCCGCAACCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 152}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065025297_1065025305 -5 Left 1065025297 10:21534845-21534867 CCAACGGTCACCGCCGCCCCCAC 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025286_1065025305 28 Left 1065025286 10:21534812-21534834 CCCAACCGCCCGCCGGGGCGCGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025289_1065025305 23 Left 1065025289 10:21534817-21534839 CCGCCCGCCGGGGCGCGCCGGCC 0: 1
1: 0
2: 3
3: 37
4: 361
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025290_1065025305 20 Left 1065025290 10:21534820-21534842 CCCGCCGGGGCGCGCCGGCCTGC 0: 1
1: 0
2: 9
3: 29
4: 241
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025292_1065025305 16 Left 1065025292 10:21534824-21534846 CCGGGGCGCGCCGGCCTGCGCCC 0: 1
1: 1
2: 1
3: 31
4: 314
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025287_1065025305 27 Left 1065025287 10:21534813-21534835 CCAACCGCCCGCCGGGGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 217
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025294_1065025305 6 Left 1065025294 10:21534834-21534856 CCGGCCTGCGCCCAACGGTCACC 0: 1
1: 0
2: 1
3: 11
4: 83
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025291_1065025305 19 Left 1065025291 10:21534821-21534843 CCGCCGGGGCGCGCCGGCCTGCG 0: 1
1: 0
2: 1
3: 23
4: 180
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025295_1065025305 2 Left 1065025295 10:21534838-21534860 CCTGCGCCCAACGGTCACCGCCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152
1065025296_1065025305 -4 Left 1065025296 10:21534844-21534866 CCCAACGGTCACCGCCGCCCCCA 0: 1
1: 0
2: 1
3: 7
4: 90
Right 1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065025305 Original CRISPR CCCACCTGGGCCGCAACCGC CGG Intronic
900151791 1:1182122-1182144 CCCACCCGGGCCCCTCCCGCTGG - Intronic
900344153 1:2203213-2203235 CCCACCTGGGCTGCAGGCGAAGG - Intronic
901805496 1:11736170-11736192 GGCACCTGCGCCGCAGCCGCGGG - Exonic
902182279 1:14698308-14698330 CCCACCTGGGTCTCCACCCCTGG - Intronic
902372186 1:16013836-16013858 CCCCCCTGGGCAGGAACCCCAGG - Intergenic
903182895 1:21613981-21614003 CTCACCTGAGCAGCAGCCGCAGG + Exonic
903349769 1:22710761-22710783 CCCACCTGAGCCGCGGGCGCGGG - Intergenic
906960249 1:50415736-50415758 CCGACCTGGGCTTCCACCGCGGG + Intergenic
918905526 1:190487479-190487501 CCCACCTCAGCCTCAACCGGAGG - Intergenic
919640707 1:200041487-200041509 CCCACCTGGGACGCCTCCGTAGG + Intronic
922917579 1:229271176-229271198 TCCGGCTGGGCCGCAGCCGCTGG + Exonic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1065025305 10:21534863-21534885 CCCACCTGGGCCGCAACCGCCGG + Intronic
1065727308 10:28678067-28678089 CCCTCCTGCGCCGGAGCCGCAGG + Intronic
1066652090 10:37665865-37665887 GCCCCCTGGGCAGCAACAGCAGG + Intergenic
1069569665 10:69486722-69486744 CCCACCTGGGCTGGAATCACAGG - Intronic
1070778315 10:79123107-79123129 CTGGCCTGGGCTGCAACCGCAGG + Intronic
1072786458 10:98286456-98286478 CCCTCCTGGGATGCTACCGCTGG + Intergenic
1077299493 11:1840458-1840480 CCCACCTGGGCCACCCCCCCGGG - Intronic
1078110596 11:8388847-8388869 CCTACCTGGGTCCCAACCTCAGG + Intergenic
1078316706 11:10299367-10299389 CACACATGGACCGCAACTGCAGG - Intergenic
1082278631 11:50246933-50246955 CCCACTTGGCCAGCATCCGCAGG + Intergenic
1083938978 11:65885026-65885048 GCCACCTGGGCCCCTACTGCAGG + Intronic
1084264882 11:67999740-67999762 CCAAACGGGGCCACAACCGCAGG + Intronic
1084522846 11:69675109-69675131 CCGCCCTGGGCCGCAGCCGGCGG + Intronic
1084899298 11:72297860-72297882 CCCACCTGGGACCCATCCTCAGG - Intronic
1087200679 11:95341499-95341521 CCCACATGGGTCGCAGCCTCTGG + Intergenic
1088606608 11:111539764-111539786 CCCATCTGGGCCACGACCTCTGG - Intergenic
1088748894 11:112827285-112827307 CCCACCTGGCCCACTAACGCTGG + Intergenic
1092894952 12:13001680-13001702 CCCACCTGGGACGCAACCCCGGG + Intergenic
1096455123 12:51778533-51778555 CCCACCTCGGCCACAACACCTGG + Intronic
1096783959 12:54006647-54006669 CCCACCAGTCCCGCAACCCCTGG - Intronic
1097250356 12:57629051-57629073 CCCACCTGGGTCTCTACCCCAGG - Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1100364854 12:93910741-93910763 CCCAACTGGGCTGCATCCTCAGG + Intergenic
1101167747 12:102055590-102055612 CCCACCTGGGCCCAAAGTGCTGG + Intronic
1104986219 12:132598852-132598874 CTCACCTGGGCCCAGACCGCGGG + Intergenic
1105560486 13:21485849-21485871 CCCACCTTGGCCTCAAGTGCTGG - Intergenic
1106340281 13:28820390-28820412 TCCACCTGCGCCGCCGCCGCCGG + Exonic
1106498516 13:30305521-30305543 CCCACCTGGGCTGAAATCCCAGG + Intronic
1109370290 13:61413813-61413835 CAGACCTGGGCAGCAGCCGCAGG + Exonic
1111937231 13:94569850-94569872 CCCACCTGGGCAGAAATGGCTGG - Intergenic
1114800164 14:25765044-25765066 CCCGCCTGGGCCTCAAGTGCTGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1121342885 14:93115691-93115713 CCCAGCCGGGCCGTAACCCCTGG + Intronic
1122272928 14:100576394-100576416 CCCAGCTTGGGCGCAACCCCAGG - Intronic
1122940304 14:104978188-104978210 CCCACCTGGCCCGGAACCCCCGG - Exonic
1122947891 14:105021420-105021442 CCCACGTGGGCCCCAGGCGCAGG - Intergenic
1122953842 14:105060878-105060900 CCCTCCCGGGCCCCAGCCGCAGG + Intronic
1123776179 15:23582988-23583010 CCCACCTCGGCCTCACCTGCTGG + Intronic
1124158766 15:27250868-27250890 TCCTCCTGGGCAGCACCCGCTGG + Intronic
1125577261 15:40764289-40764311 CCCTCCTGGGCTGCACCCACCGG + Intronic
1125782846 15:42285946-42285968 CCCCCCTGGGCTGCAGCCTCAGG + Intronic
1130767765 15:86889544-86889566 CCCACCTGGCCCCCAACGGCAGG + Intronic
1132355728 15:101169921-101169943 ACCATCTGGGCCGCATCCTCAGG - Intergenic
1132948067 16:2543561-2543583 CCCACCTGGGCCGCACAGGCTGG - Intronic
1132966380 16:2657781-2657803 CCCACCTGGGCCGCACAGGCTGG + Intergenic
1133065824 16:3206490-3206512 CCCACCTGAGCCGCAAAACCAGG - Intergenic
1136711573 16:32241238-32241260 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136756342 16:32688167-32688189 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1136811770 16:33182207-33182229 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136818246 16:33292287-33292309 CCTGCCTGGGCCGCGGCCGCCGG + Intronic
1136824810 16:33348820-33348842 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136829876 16:33447591-33447613 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1141620537 16:85234831-85234853 CCCAGCTGGGCCGTATTCGCTGG - Intergenic
1142138295 16:88461353-88461375 GCCACCTGGGCTGCACCCTCAGG + Intronic
1202990348 16_KI270728v1_random:5175-5197 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1203058481 16_KI270728v1_random:948521-948543 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1142481889 17:224153-224175 CCCACCAGGGCCCCACCTGCAGG + Intronic
1143503303 17:7351215-7351237 CCCAGGTGGGCCCCAACCGCCGG + Intronic
1145777814 17:27541454-27541476 CCCAACTGGGCCACCACCTCTGG - Intronic
1146167541 17:30601238-30601260 CCCACCTGGGCCGTAGCCCAGGG - Intergenic
1146581156 17:34040010-34040032 CCCGCCCGGGCAGCCACCGCCGG + Intronic
1146913465 17:36663104-36663126 CCCACCTGGGCAGCATGCCCTGG - Intergenic
1147285685 17:39401407-39401429 CCGGCCCGGGCCGCACCCGCCGG - Exonic
1150137670 17:62704388-62704410 CCCAGCCCGGGCGCAACCGCGGG - Intronic
1150211923 17:63446420-63446442 CCGAGCGTGGCCGCAACCGCGGG - Intergenic
1150821882 17:68441706-68441728 CCCACCCAGGCCACAACCTCAGG + Intronic
1151978341 17:77494888-77494910 CCCAGCTGGGCAGCTCCCGCAGG - Intronic
1160343150 18:78107171-78107193 CCCACCTGAGGCACAACCCCAGG - Intergenic
1160909759 19:1469112-1469134 CCGGCGTGGGCCGCCACCGCTGG + Exonic
1161447998 19:4328721-4328743 CCCCGCTGGGCCGCAGCAGCAGG + Exonic
1161619540 19:5290935-5290957 CCCCCCTGGGCAGCAAGCACAGG + Intronic
1161802633 19:6424546-6424568 CCCGCCCGGGCCGCCGCCGCCGG + Exonic
1161856222 19:6767382-6767404 CTCACCTGGGCAGGACCCGCGGG + Exonic
1162886349 19:13700274-13700296 CCCAGCTGGGCCCCAACTCCAGG - Intergenic
1163091187 19:15021532-15021554 CCACCCTGGCCCGCAGCCGCAGG - Intronic
1166151784 19:40880384-40880406 CCCACCTAGTCCCCATCCGCAGG + Intronic
1167284520 19:48591613-48591635 TCTACATGGGCCGCAACCCCCGG + Exonic
927256456 2:21044249-21044271 CCCACCTGGGACCCAGCCCCTGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
936977315 2:118232749-118232771 CCCACCTGAGCCCCTATCGCTGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948800078 2:240429542-240429564 CCTCCCTGGGCCGCAGCCCCAGG + Intergenic
948807868 2:240460763-240460785 CCCACCTGTGCCCCTACCCCAGG + Intronic
948846850 2:240687449-240687471 CCCACCTGGGGCCCATCAGCTGG - Intergenic
1168814579 20:728132-728154 CCCTCCTGCGCCGCCCCCGCGGG - Intergenic
1172117423 20:32581276-32581298 CCCACTTGGGCCCCAGCTGCAGG + Intronic
1172229450 20:33327077-33327099 CCCACCTGTGCCCCCACCCCCGG + Intergenic
1172293300 20:33791210-33791232 CCCACCACTGCCGCAACTGCGGG - Exonic
1178311200 21:31531353-31531375 CACACAAGGGCCGCAACCCCTGG + Intronic
1178624224 21:34202118-34202140 CCCGCCAGGGCCGCCACCGAGGG - Intergenic
1178914744 21:36699960-36699982 CCCGCCTGGGCCGGGGCCGCCGG - Intronic
1179674766 21:42974210-42974232 CTCTCCTGGGCGGCAACCGAGGG + Intergenic
1179989470 21:44939765-44939787 CCGACCTTGGACGCAACCCCGGG + Exonic
1180184183 21:46131375-46131397 CCCACCTGGGCTGCCACAGAAGG + Intronic
1180614793 22:17120274-17120296 GCCCCCTCGGCCGCTACCGCTGG - Exonic
1180951870 22:19724094-19724116 CACACCTGGGCGCCAACCCCTGG + Exonic
1181610397 22:24007772-24007794 CCCACCTGGGCAGCTCCAGCTGG + Intergenic
1182354788 22:29717924-29717946 CCCACCTGGACAGCAAGCCCAGG + Intergenic
1182871266 22:33649977-33649999 CCCAACTGGGCCACAACTCCAGG + Intronic
1185129970 22:49033321-49033343 CCCACCCGGCCCGCACCCTCTGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950669528 3:14517789-14517811 CCCACCTGGGCCACACCTGCTGG - Exonic
952277655 3:31892819-31892841 CCAAACTGGGCAGCAACCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954335164 3:49911996-49912018 CCCTCCTGGCCCGCACCTGCAGG + Exonic
954782808 3:53073361-53073383 CCCACCTGTGCCGCAAGTGGAGG + Intronic
956640887 3:71414368-71414390 TCCACCTGGGCCTCAGCCTCTGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
968645783 4:1739895-1739917 CCCACCTGGCCTGGGACCGCTGG + Intronic
969248938 4:5954571-5954593 CCCACCTAGGCCTCCACGGCAGG + Intronic
979523816 4:121697044-121697066 CCCGCCAGGGCCCCAACCGCAGG + Exonic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984632968 4:182079759-182079781 CCCACCTGGGCAGCACGTGCTGG - Intergenic
985150943 4:186946368-186946390 CCCCCCTGCCCCGCCACCGCAGG - Intergenic
985692865 5:1323267-1323289 CCCACCTGGGCAGCAGAGGCTGG + Intronic
985760191 5:1744997-1745019 CTCACCTGGGAAGCAACAGCTGG + Intergenic
986152567 5:5140556-5140578 CCCACCAGCGCGGAAACCGCGGG + Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
992635074 5:78719077-78719099 CCCACCTGGGGTGTAACTGCAGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997529292 5:134572179-134572201 CCACCCTGGGCTGCAACCACCGG - Intronic
998609669 5:143674359-143674381 CCCACTTGGGCAGAAACAGCAGG - Intergenic
1001412526 5:171521018-171521040 CCCACCTGCCCCGCAACAGCAGG + Intergenic
1002660840 5:180790368-180790390 CCCACCTGGCCCCCATCCCCTGG + Intergenic
1006298307 6:33179750-33179772 GCCTCCTGGGCCGCCACCACAGG + Exonic
1006321747 6:33323258-33323280 CCTGCCTGGGGCCCAACCGCCGG + Intronic
1013836551 6:114342203-114342225 CCCGCCCGCGCCGCCACCGCCGG - Exonic
1017169227 6:151440201-151440223 CCCACCTCGGCCTCAAGTGCTGG + Intronic
1017822864 6:158061484-158061506 CCCACCTGGGCCACTTCAGCTGG + Intronic
1018966176 6:168490874-168490896 CACACCTGGGCAGCAACAGAGGG - Intronic
1019537995 7:1538809-1538831 CAGACCTGGGCTGCAGCCGCCGG - Intronic
1019735312 7:2647400-2647422 CACACCTGCGCCGGACCCGCGGG - Exonic
1020069797 7:5219233-5219255 CCCAACTGGGCAGCAACAGAGGG + Intronic
1020859175 7:13467089-13467111 GCCACCTGGGCCTCAACCAGGGG + Intergenic
1024247161 7:47479359-47479381 GCCACCTGGGCCTCAGCCCCTGG + Intronic
1026771282 7:73201550-73201572 CCCACCTGAGCACCAACCCCAGG + Intergenic
1027012149 7:74754947-74754969 CCCACCTGAGCACCAACCCCAGG + Intronic
1027075892 7:75191107-75191129 CCCACCTGAGCACCAACCCCAGG - Intergenic
1027256301 7:76432861-76432883 CCCACCTGGGCCCCCACTGATGG - Intronic
1030079842 7:105767815-105767837 CCCACATGGGCTGCAGCTGCTGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1036143998 8:6236028-6236050 CCCTGCTGGGCCCTAACCGCAGG - Intergenic
1049577114 8:143394523-143394545 CTCACCAGGGCAGCACCCGCTGG - Intergenic
1049602478 8:143514308-143514330 CCCACCCGGGCTGCCACCGCAGG + Intronic
1052837746 9:33264478-33264500 CCCACCAGGGGCGCCGCCGCCGG - Exonic
1056796810 9:89664182-89664204 CCCACCTGGACCGCCAGCTCTGG - Intergenic
1060549396 9:124477940-124477962 TCCACCTGGGCCCCACCCTCCGG + Intronic
1061873869 9:133534510-133534532 CGCTCCTGGGCCGCCGCCGCCGG + Intronic
1062196611 9:135277643-135277665 CCCTCCTGAGCCGCCAACGCAGG + Intergenic
1187648294 X:21374030-21374052 CCCGCCGTGGCCGCCACCGCCGG + Intergenic