ID: 1065030282

View in Genome Browser
Species Human (GRCh38)
Location 10:21579086-21579108
Sequence TTCAAAAATAAAGATGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1680
Summary {0: 1, 1: 0, 2: 13, 3: 167, 4: 1499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065030282_1065030287 14 Left 1065030282 10:21579086-21579108 CCTATTTCATCTTTATTTTTGAA 0: 1
1: 0
2: 13
3: 167
4: 1499
Right 1065030287 10:21579123-21579145 GATTTAGAATTCTGTGTTGACGG No data
1065030282_1065030286 -8 Left 1065030282 10:21579086-21579108 CCTATTTCATCTTTATTTTTGAA 0: 1
1: 0
2: 13
3: 167
4: 1499
Right 1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065030282 Original CRISPR TTCAAAAATAAAGATGAAAT AGG (reversed) Intronic
900508877 1:3047943-3047965 TTCAAAAACTAAGATGAAGGAGG + Intergenic
900834146 1:4987021-4987043 TTAAAAAATAAAAATCAAACTGG + Intergenic
901547525 1:9969776-9969798 TTCAAAAGAACAGATAAAATGGG + Intronic
901580564 1:10239578-10239600 ATAAAAAATAAAAATGAAAACGG - Intronic
901599538 1:10412092-10412114 TCCAAAAAATAAGATGAAATTGG - Intronic
901749040 1:11394648-11394670 TTCAAAAAAAAAAAAAAAATTGG + Intergenic
902049524 1:13551688-13551710 TTGGAAAATATAGATGAAATAGG + Intergenic
902223200 1:14979870-14979892 TTAAAAAATAAAAAATAAATAGG - Intronic
902333147 1:15740688-15740710 CTCAAAAAAAAAGATGATGTTGG - Exonic
902491386 1:16784176-16784198 TTGAAAAAGAAAAATGAAATGGG - Intronic
902904779 1:19548157-19548179 TTGAAAAAAAAAAATGAAGTTGG - Intergenic
903279648 1:22243424-22243446 TTCAAAAAAAAAGAAGAAGAAGG + Intergenic
903440163 1:23382046-23382068 TTCAAAAAAAAAAAAAAAATTGG - Intronic
903863760 1:26382540-26382562 TTTTAAAATAAAAATAAAATAGG + Intergenic
903948155 1:26977240-26977262 TTCAGAAAGAAACATGTAATAGG - Intergenic
904179821 1:28658351-28658373 TACAAAAATAAAAAAAAAATTGG + Intergenic
904657081 1:32057179-32057201 CTCAAAAATAAAAATAAAAAAGG - Intronic
904752649 1:32750504-32750526 TCAAAAAATAAAAATGAAAATGG - Intronic
905021808 1:34821490-34821512 TTCAACAATATAGATAAAATGGG + Intronic
905160170 1:36026038-36026060 CTCAAAAAAAAAAAAGAAATTGG + Intronic
905496848 1:38396572-38396594 TACAAAAATGAAGATAAAATAGG + Intergenic
905724454 1:40238273-40238295 TATAAAAATAAACATCAAATTGG + Exonic
905819360 1:40978068-40978090 TTTAAAAAAAAAGATGTGATGGG - Intergenic
905916537 1:41688491-41688513 ATCAAAAATTAAAATGAACTGGG - Intronic
906222531 1:44092912-44092934 TTCAAAAATTAAAAGCAAATGGG + Intergenic
906234720 1:44198920-44198942 TTCAGAAATAAAGACTAAACTGG - Intergenic
906387631 1:45385181-45385203 TTTAAAAATATAGATGTAATAGG + Intronic
906541296 1:46588488-46588510 TTAAAAAATAAAAATAACATTGG - Intronic
906629354 1:47352430-47352452 TACAAAAATAAAGATGTAACTGG + Intronic
906804605 1:48768421-48768443 TTCAAAAATATAGAAGAACTTGG + Intronic
907138632 1:52163490-52163512 TTAATAAATAAAAATAAAATAGG - Intronic
907154584 1:52321838-52321860 TTCCAAAATGAATACGAAATGGG - Intronic
907653280 1:56317017-56317039 GTCAAAAATAAAGAAAATATAGG + Intergenic
907690243 1:56657380-56657402 TTCAAAAATAAAGGTAAGCTGGG + Intronic
907885366 1:58588027-58588049 ATCAAAATTAAAGATGAGACTGG + Intergenic
908082250 1:60593520-60593542 TTCATAAATAAAGAAGAACCAGG + Intergenic
908373844 1:63512946-63512968 TACAAAAATAAAAATAAAAATGG - Intronic
908432079 1:64069133-64069155 TTAAAAAAAATTGATGAAATTGG - Intronic
908435283 1:64099754-64099776 GTTGAAAATAAAGATCAAATAGG + Intronic
908695045 1:66830474-66830496 TACAAAAATAAAAATAAATTAGG + Intronic
908812235 1:67994575-67994597 TTTAAAAGAAAAGAAGAAATTGG + Intergenic
909195926 1:72623226-72623248 TTCAACAACTTAGATGAAATGGG - Intergenic
909202993 1:72715701-72715723 TTGAAAAAAAAAAATAAAATAGG - Intergenic
909252663 1:73379022-73379044 ATCAAAAAGAAAAAAGAAATGGG - Intergenic
909565887 1:77053175-77053197 TTTCAAAATAAAGATAAAAGAGG - Intronic
909605346 1:77502332-77502354 TTAAAAAGGAAAGAGGAAATGGG + Intronic
909680990 1:78291975-78291997 TTAAATAATAAAAATGAAAATGG - Intergenic
909771902 1:79434131-79434153 GTTAAAAATAAATTTGAAATAGG + Intergenic
910009527 1:82444041-82444063 TTAAAAAATAAGAATGACATTGG + Intergenic
910222929 1:84907127-84907149 TTGAAAAATATAAATGAAATAGG + Intergenic
910328612 1:86041365-86041387 ATTGAAAATAAACATGAAATTGG - Intronic
910336291 1:86135608-86135630 CTCATAAATCAAGATGAAATGGG - Intronic
910521955 1:88133067-88133089 TTCTAAAAACAAGCTGAAATGGG - Intergenic
910587343 1:88893991-88894013 ATCAATAATAAATATTAAATGGG - Intergenic
910615753 1:89196733-89196755 TTAAAAAATAAATATGAAGAAGG - Intronic
911321552 1:96419160-96419182 TTAAAAAATAAAAATAAAAATGG - Intergenic
911555135 1:99334585-99334607 TTAAAAGATAAAGAACAAATTGG - Intergenic
911572360 1:99533252-99533274 TTAAAAAAAAAAAATCAAATAGG + Intergenic
911589628 1:99731820-99731842 TTAAAAAATAAAAAATAAATCGG - Intronic
911591350 1:99751660-99751682 CTCAAAAGTGAAGAAGAAATAGG + Intronic
911792528 1:102035656-102035678 TTGAAAAATAATAAGGAAATAGG - Intergenic
912002423 1:104851640-104851662 TTAAAAAAAAAAAATGTAATAGG + Intergenic
912030555 1:105237612-105237634 TTCAAAAATAAGTATAAAAATGG - Intergenic
912190882 1:107338870-107338892 TTTAAAAAAAAAAAGGAAATAGG + Intronic
912230994 1:107792353-107792375 TTTAAAAATACAGCTCAAATCGG + Intronic
912612940 1:111066883-111066905 TTTAAAAATACAGTTGAAACAGG - Intergenic
912752906 1:112300322-112300344 TCCAAATATCAAGAAGAAATGGG - Intergenic
913203642 1:116516256-116516278 TTTAAAAATAATTATTAAATAGG + Intronic
913425825 1:118728267-118728289 TGCAAAAAAAAAAGTGAAATGGG + Intergenic
913720792 1:121592123-121592145 TTGAAAAATAGAAATGAAGTTGG + Intergenic
913956001 1:143294064-143294086 TTGAACAATAAATATGATATAGG + Intergenic
913981433 1:143521376-143521398 TTGAACAATAAATATGATATAGG - Intergenic
914051069 1:144132211-144132233 TTCTAAAATAATTTTGAAATAGG - Intergenic
914075806 1:144348031-144348053 TTGAACAATAAATATGATATAGG - Intergenic
914103372 1:144618465-144618487 TTGAACAATAAATATGATATAGG + Intergenic
914128112 1:144833232-144833254 TTCTAAAATAATTTTGAAATAGG + Intergenic
914238092 1:145830796-145830818 CTCAAAAAAAAAAAAGAAATTGG + Intronic
914378702 1:147096910-147096932 TTCAAAAATGAAGATGAGGCTGG - Intergenic
914679443 1:149928699-149928721 TACAAAAATACAGAGGAGATAGG + Exonic
914874946 1:151506428-151506450 TTCAAGAACTAAGATGAGATGGG - Intergenic
914972500 1:152322855-152322877 TTAAAAAATAAAGATTAATAAGG + Intronic
915147452 1:153803426-153803448 TTCAAAAATAAAAATCAAATGGG - Intergenic
915411178 1:155701860-155701882 TTCAAAAAGAATAATTAAATCGG + Intronic
915791102 1:158672291-158672313 TACAAAAATAAACAGCAAATGGG + Intronic
915792481 1:158689010-158689032 TTCACATAAAAAAATGAAATTGG + Intergenic
915842330 1:159224553-159224575 TTCTCCAATAAAAATGAAATTGG - Intergenic
915984191 1:160447102-160447124 TAAAAAAATAAACAGGAAATGGG - Intergenic
916123037 1:161545785-161545807 TTAAAAAATAATGATGTTATAGG + Intronic
916286010 1:163106526-163106548 TACAAAAGCAGAGATGAAATCGG + Intergenic
916540898 1:165753094-165753116 TTAATAAATAATGAGGAAATTGG + Intronic
916705877 1:167349398-167349420 TGGAAAAATAAAGAGGAAAAGGG - Intronic
917106927 1:171501688-171501710 TTCAAAATTAAAATTGATATAGG + Intronic
917107367 1:171506195-171506217 TCCAAAAATAAAGGCAAAATTGG - Intronic
917339271 1:173957717-173957739 TTTAAAAATAAAAATGAGCTAGG - Intronic
917407161 1:174719267-174719289 TTAATAATTAAAGATAAAATTGG + Intronic
917614786 1:176731087-176731109 AACAAAAATAGAGATAAAATTGG - Intronic
917660967 1:177176450-177176472 TTAAAAAATAAAAAAGAAATGGG - Intronic
917948291 1:180000633-180000655 TCCAAATACAAAGATGACATTGG + Intronic
918025632 1:180741990-180742012 ACCAAAAATAAAAATGAAATAGG - Intronic
918595046 1:186283409-186283431 TACAAAAATAATGATGGAAATGG + Intergenic
918662794 1:187109617-187109639 TTCAAAAATAAAAACCAAAAAGG - Intergenic
918694537 1:187528040-187528062 TTCAAAAATAATGATATAAAAGG - Intergenic
918754053 1:188313649-188313671 TTCAAAAATCCAGGTGAAAACGG - Intergenic
918922853 1:190736836-190736858 GTCAAAGAAAAATATGAAATTGG - Intergenic
919053726 1:192542860-192542882 TTAAAAATTATACATGAAATAGG - Intergenic
919212435 1:194505268-194505290 TTCAAAAGGAAAGATGTATTAGG + Intergenic
919298073 1:195726518-195726540 TTTAAAGCTAAAGATAAAATAGG - Intergenic
919364670 1:196642371-196642393 TTAAAAAAAAAAAATTAAATTGG + Intergenic
919436215 1:197564753-197564775 TTCAAAACTAATGATTAAAGAGG - Intronic
919496932 1:198284437-198284459 TTCAGAAGTAAACAGGAAATAGG + Intronic
919553254 1:199019234-199019256 TTCAAAAATCCTCATGAAATAGG - Intergenic
919711137 1:200729850-200729872 TTCAAAATGAAAGCTGGAATTGG - Intergenic
920220216 1:204392270-204392292 TTCAAAAGTAAATATAAAACTGG + Intergenic
920399288 1:205667203-205667225 TACAAAAATAAAAATAAAATAGG + Intronic
920733392 1:208509895-208509917 TGCAAAAATCAAGGTGAAACAGG + Intergenic
920753983 1:208709846-208709868 TTAAAATATAATGCTGAAATGGG - Intergenic
920984122 1:210868536-210868558 CTCAAAAATTAACTTGAAATAGG - Intronic
921080219 1:211733129-211733151 TTAAAAAATAAAAATAAAAGAGG - Intergenic
921145757 1:212354380-212354402 TTAAAAAATAAAAATGGAACTGG + Intronic
921161644 1:212476931-212476953 CTGAAAAATAAAAAAGAAATGGG - Intergenic
921353809 1:214265344-214265366 TTTTAAAATAAAAATGAAAACGG + Intergenic
921486813 1:215724613-215724635 TACAAAAATAAAAATGAAATGGG + Intronic
921587458 1:216964929-216964951 TTCATAAACAAAGATCCAATAGG + Intronic
921727074 1:218535560-218535582 TTCAAAAATAAAGGGGCAAAAGG - Intergenic
921839331 1:219811679-219811701 TTGAAAAATGAATACGAAATAGG - Intronic
922060225 1:222082195-222082217 TTCAAAACTCATGATGAAATTGG - Intergenic
922520029 1:226241855-226241877 TTCAAAAAAAAAAAAGAAAAGGG + Intronic
922540111 1:226412610-226412632 TTGTAAAATAAAGATAAAGTTGG - Intergenic
922588933 1:226758426-226758448 ATCAAAAAAAAAAATGGAATAGG + Intergenic
922773436 1:228202469-228202491 TTTAAAATTAAAAATAAAATGGG + Intergenic
923003722 1:230028503-230028525 TACGTAAATAAAGATCAAATTGG - Intergenic
923232478 1:231999911-231999933 TTCAAAAATAAAAATTCCATTGG + Intronic
923232903 1:232005289-232005311 TTCAAAAATAAAAGTAAAATAGG - Intronic
923477155 1:234345005-234345027 TTAAAAAATAAAAATTAGATGGG + Intergenic
923529057 1:234798367-234798389 TTGAAAAAGAAAAATGAAATGGG + Intergenic
923743321 1:236676381-236676403 TTCCAAAACTAAGATGAATTCGG + Intergenic
923927877 1:238656285-238656307 TACAAAAATAAAAATAAAAATGG - Intergenic
923930791 1:238693497-238693519 TTCAAAAATAAAAATAAAAAAGG + Intergenic
923934468 1:238746068-238746090 TTCAGAAATAAAAATGAGAGAGG - Intergenic
924325031 1:242887182-242887204 TTCAAAGATAAATATGCAAACGG + Intergenic
924372286 1:243363680-243363702 TTCATAAAGAAAAATAAAATAGG - Intronic
924496858 1:244598817-244598839 TTCAAAGAGAAAGTTGAGATGGG - Intronic
924505254 1:244677096-244677118 TTCCAAAATACAGAAGAAAGGGG - Intronic
924568311 1:245216081-245216103 TTAAAAAATAAATAAGTAATAGG + Intronic
924674639 1:246163734-246163756 TTAAAAAAGAAACAGGAAATCGG + Intronic
924688951 1:246325637-246325659 TTCAGAAAGAAAGAAGAACTAGG + Intronic
924757661 1:246956286-246956308 TTTAAAAATAATGATCCAATCGG - Intronic
924872320 1:248061890-248061912 TGCAGAAATAGAAATGAAATTGG + Intronic
924906620 1:248460394-248460416 ACCAAAACTAAAGAGGAAATAGG - Intergenic
1062846337 10:709242-709264 TGGAAAAAAATAGATGAAATGGG - Intergenic
1062974983 10:1676525-1676547 CTCAAAAATAAAAATGAAGGGGG - Intronic
1063020635 10:2123734-2123756 TTAAAAAATAAATATACAATAGG + Intergenic
1063149751 10:3325402-3325424 TTAAAAAATAAAAATAAATTAGG - Intergenic
1063226594 10:4020717-4020739 TTTAAAAATAAAGTTGGAAATGG + Intergenic
1063409572 10:5826713-5826735 CTCAAAAATAAAAAAGAAATAGG + Intronic
1063593748 10:7413860-7413882 TTCTGAAATAAAAATGAAAGTGG - Intergenic
1063746303 10:8886934-8886956 TTAAAAAATAAAAATAAAGTTGG + Intergenic
1063769460 10:9181445-9181467 TTCAAAATTCAATATGAAATAGG - Intergenic
1063813738 10:9745832-9745854 TTACAAAATAAATATGATATAGG - Intergenic
1063855483 10:10246996-10247018 TTCTAAAATAAAGATGTATTTGG - Intergenic
1063863308 10:10335967-10335989 TTCAATTATGAAGGTGAAATAGG + Intergenic
1063921091 10:10933741-10933763 TTCAACAATATGGATGAACTTGG - Intergenic
1064524336 10:16237989-16238011 TGGAAATATAAAGATGAAGTTGG + Intergenic
1064574929 10:16735242-16735264 ACCAAGAATAAAGATGAAAATGG + Intronic
1064587990 10:16858675-16858697 TTCACAAAGAAAAATGAAGTGGG + Intronic
1064879411 10:20033398-20033420 TGCCAAAATGAAGAAGAAATGGG - Intronic
1065030282 10:21579086-21579108 TTCAAAAATAAAGATGAAATAGG - Intronic
1065398723 10:25271374-25271396 CTAAAAATTAAAGATAAAATTGG - Intronic
1065423911 10:25579029-25579051 TAAAAAAATAAAGATTAAAGGGG + Intronic
1065585589 10:27214383-27214405 TACAAAAATAAAGTGGAGATGGG + Intronic
1065854041 10:29815345-29815367 TTCAAAAAGAAAGAAAAAAAAGG + Intergenic
1065982578 10:30915246-30915268 TTCAATACTTAGGATGAAATTGG + Intronic
1066006285 10:31149060-31149082 TTAAAAAAATAAGATAAAATGGG + Intergenic
1066105885 10:32156645-32156667 TAAAAAAATAAAGAAAAAATAGG + Intergenic
1066551029 10:36557381-36557403 TTCAGAAGCAAAAATGAAATTGG + Intergenic
1066750890 10:38655708-38655730 TACAAAAATAAAAATGAGAAAGG + Intergenic
1066760863 10:38751095-38751117 TTCTAAAATAATTTTGAAATAGG + Intergenic
1066954979 10:42157663-42157685 TTGAACAATAAATATGATATTGG + Intergenic
1066960716 10:42221327-42221349 TTCTAAAATAATTTTGAAATAGG - Intergenic
1067184922 10:44018958-44018980 CTATAAAATAAAAATGAAATGGG + Intergenic
1067785726 10:49244714-49244736 TTCATACATGAAGCTGAAATTGG - Intergenic
1067818843 10:49508503-49508525 TTCATAAAGAAAGATGAAAAGGG + Intronic
1067901191 10:50243496-50243518 TTCAAAAATTAAAAAGAAAAAGG + Intronic
1068167201 10:53345609-53345631 TTCAAGAATAAAGAGAAAGTTGG - Intergenic
1068198637 10:53752004-53752026 TTCAAAATTTAACATAAAATGGG + Intergenic
1068388703 10:56364034-56364056 TTCAAAAATGAAGACTAACTAGG + Intergenic
1069189966 10:65474951-65474973 TTCAGAAAGAAATATCAAATTGG + Intergenic
1069247787 10:66229452-66229474 TTCAGAAATAAAAAAGAAATAGG - Intronic
1069308533 10:67003627-67003649 TTGAAAAAGTAATATGAAATAGG - Intronic
1069422360 10:68258662-68258684 TTCAGAAAAAAAGATAAAAATGG - Intergenic
1069467091 10:68650644-68650666 ATAAAAAATAAAGGTGAAAAAGG + Intronic
1069469542 10:68675730-68675752 TTTAGAAATTAAGATAAAATTGG + Intronic
1069475463 10:68728259-68728281 TTTAAAAAAATATATGAAATGGG - Intronic
1069513520 10:69059371-69059393 ATAAAAAATAAAGATGAAGTGGG + Intergenic
1070004024 10:72404665-72404687 TTCAATAACATAGATGACATGGG + Intronic
1070018873 10:72563961-72563983 AACATAAATAAAGAAGAAATAGG + Intronic
1070079628 10:73172801-73172823 TTAAAAAAGAAAGGTGAAATTGG + Intronic
1070419266 10:76220508-76220530 TACAAAAATCTAGAAGAAATGGG + Intronic
1070439108 10:76425251-76425273 CTCAAAAATAATGGTGACATTGG - Intronic
1070445565 10:76497585-76497607 TTCAAAAAGAGAACTGAAATAGG - Intronic
1070832577 10:79428616-79428638 TTTAAAAGTAAAGATGCAAGTGG + Intronic
1070871495 10:79757895-79757917 TATAAAAACAAAGATGGAATGGG + Intergenic
1071049197 10:81426065-81426087 TTCATGAGTAAAGATAAAATTGG + Intergenic
1071123466 10:82307744-82307766 GGAAAAAAAAAAGATGAAATTGG - Intronic
1071205844 10:83276385-83276407 TTCAAAATAAGAGTTGAAATTGG + Intergenic
1071556602 10:86607944-86607966 TTCCAGAAGAAAGAAGAAATAGG - Intergenic
1071638427 10:87280103-87280125 TATAAAAACAAAGATGGAATGGG + Intergenic
1071656815 10:87457849-87457871 TATAAAAACAAAGATGGAATGGG - Intergenic
1071925040 10:90396643-90396665 TTCAAAAAGAAAGAGGCAGTGGG + Intergenic
1071986801 10:91059994-91060016 TTCTAGAATAAACATGAAACAGG - Intergenic
1072312917 10:94173526-94173548 TTTAAAAATAAAGACAAGATAGG - Intronic
1072476494 10:95765627-95765649 TTTAAAAAATAAAATGAAATTGG - Intronic
1073210246 10:101795080-101795102 TTGTAAAATAAATATGAAACAGG + Intronic
1073211707 10:101808967-101808989 TTCAAAAAAAAAAAGGAAAATGG + Intronic
1073379741 10:103068827-103068849 TTCAAAAAAAAAGTTCAAAAAGG - Intronic
1073410418 10:103337327-103337349 TTCAAAAATAAAGGTTAAAGTGG - Intronic
1073734320 10:106328020-106328042 TTACAAAATAAAGATTTAATTGG + Intergenic
1073749116 10:106504058-106504080 TTAAAAAATAAAAATGCTATTGG + Intergenic
1073868499 10:107833189-107833211 TTCATAAATAAAAATGTAAGTGG + Intergenic
1074341396 10:112633734-112633756 TTCACCAACAAGGATGAAATAGG - Intronic
1074609845 10:115010963-115010985 TTTAAAAATTAATATGCAATGGG - Intergenic
1074619340 10:115102766-115102788 TTCAAAAATAAAAATAAAGTTGG - Intronic
1074697315 10:116061378-116061400 TGGAAAAATAAATATGTAATTGG + Intronic
1074925947 10:118070803-118070825 TGAAAAACTAAAGATGAAAGTGG + Intergenic
1074998527 10:118778269-118778291 TTAAAAAATAAAAATAAAATGGG + Intergenic
1075030068 10:119017806-119017828 GTTAAAAATATATATGAAATGGG - Intergenic
1075499476 10:122959633-122959655 TTTAGAAACAATGATGAAATAGG - Intronic
1075555856 10:123431447-123431469 TTCAAAAATCAAGCTGTGATTGG - Intergenic
1075616846 10:123896494-123896516 CTGAAAATTAAATATGAAATGGG - Intronic
1076082880 10:127599544-127599566 TTTAAAAACACAAATGAAATGGG - Intergenic
1076459120 10:130627060-130627082 TTCAAGGATGAAGATTAAATAGG + Intergenic
1076467764 10:130696875-130696897 TTCCAAAATAAAGAGGAGCTGGG + Intergenic
1076934758 10:133559908-133559930 TTCAAAATTAAAGAAGCAAAAGG - Intronic
1077070431 11:668170-668192 CTCAAAAATAAAGGTGAAAGAGG + Intronic
1077452798 11:2660857-2660879 TTTAAGAATAAAGATGAATATGG + Intronic
1077729335 11:4712563-4712585 TTCAAAAATAATTTTGAAGTTGG + Intronic
1077757506 11:5049203-5049225 GAAAAAAAGAAAGATGAAATTGG - Intergenic
1077811336 11:5640681-5640703 TTCAAAAATAAAGAAGAGCAGGG - Intronic
1077832401 11:5888180-5888202 ATCAAAAATAAAGAGGGAAAGGG + Intronic
1077956427 11:7025206-7025228 TCTAAAAATAAAAATGACATTGG + Intronic
1078132760 11:8626265-8626287 TTGAAAAACAAAGAGAAAATGGG + Intronic
1078306121 11:10188148-10188170 TTTTATAATAAAGAAGAAATAGG + Intronic
1078386061 11:10893897-10893919 TTGAAAAATAAACATAAAATGGG - Intergenic
1078464443 11:11539847-11539869 ATCAGAAATAAAGAAGAAAGGGG + Intronic
1079228150 11:18626121-18626143 TTAAAAACTAGAGATGAAAGTGG - Intronic
1079600120 11:22300917-22300939 TACAAAAATACATATGCAATAGG + Intergenic
1079808694 11:24967675-24967697 TCTAAAAAGAAAAATGAAATTGG - Intronic
1079852247 11:25550101-25550123 TTGAAAAATAAAAACGAATTTGG + Intergenic
1080096418 11:28413513-28413535 TTGAAATAAAAGGATGAAATGGG + Intergenic
1080192207 11:29564420-29564442 TCCATTAATATAGATGAAATAGG + Intergenic
1080526762 11:33130125-33130147 ATGAAAAATAAAAATGAAAGAGG - Intronic
1080904972 11:36534807-36534829 TTTTAAAATATAAATGAAATAGG - Intronic
1080932247 11:36823863-36823885 TTAAAAATTAATGATGAAACAGG + Intergenic
1081011180 11:37813702-37813724 TTCAAAAATAATATGGAAATGGG - Intergenic
1081014816 11:37863523-37863545 TTCAAAAATATTGATGGCATTGG + Intergenic
1081044853 11:38260833-38260855 TTTAAAAATAAGAATGAAAATGG - Intergenic
1081047360 11:38292857-38292879 TTTAAAAACAAATATGATATTGG + Intergenic
1081204858 11:40263299-40263321 TACAGAAATGAAGATAAAATTGG + Intronic
1081422647 11:42889592-42889614 TGCAAAAACATAGATGAAACTGG + Intergenic
1081432116 11:42987756-42987778 TTCAAAAAGAAACAGGAACTTGG + Intergenic
1081531848 11:43967087-43967109 TTCAGAAATGAAGATGCATTTGG - Intergenic
1082715640 11:56609004-56609026 GCCAAACATAAAGAGGAAATAGG + Intergenic
1083385802 11:62308955-62308977 TGCAACAACATAGATGAAATTGG - Intergenic
1083846606 11:65338099-65338121 TTAAAAAATAAAAATAAAAAAGG - Intronic
1084077433 11:66791370-66791392 TACAAAAATAAATATTAAACTGG - Intronic
1085007817 11:73110538-73110560 CTCAAAATCAAAGATGAAAAAGG - Intronic
1085159804 11:74329612-74329634 TTCAAGAAGAAACATGACATAGG + Intergenic
1085928159 11:81047287-81047309 TTCAAAGATAAATATGTATTTGG - Intergenic
1086114441 11:83232631-83232653 TTGAATAATAGAGATGAAAGTGG + Intronic
1086310118 11:85526448-85526470 TTCAAAAATGAACACAAAATAGG + Intronic
1086413595 11:86567320-86567342 TTACAAAATAAAGAGGAAATTGG - Intronic
1086563825 11:88201073-88201095 ATCAAAAATAAAAATGAATCAGG + Intergenic
1086861485 11:91929856-91929878 TTCAAAAGCTAAGATGAAAGAGG + Intergenic
1087256594 11:95962710-95962732 TTAAAAAAGAAAAATAAAATTGG + Intergenic
1087339757 11:96888719-96888741 TTGAAAATTAAACATGTAATTGG + Intergenic
1087489881 11:98811597-98811619 TTCAAAAAGAAAGAATAAAAAGG + Intergenic
1087519192 11:99208606-99208628 TCCTAAAATAAAGATAAATTGGG - Intronic
1087887018 11:103493453-103493475 TTCAAAAATAAAGAGGACAACGG + Intergenic
1087888552 11:103509277-103509299 TTCAACAACATAGATGAAATTGG + Intergenic
1088169236 11:106977016-106977038 TTCAAAGATAATGATTATATTGG - Intronic
1088228905 11:107653426-107653448 TTACAAAACAAAGATGAAAATGG + Intronic
1088424194 11:109683923-109683945 AGCAAAAATAAAAATGAAAAGGG + Intergenic
1088972850 11:114788571-114788593 CTCCAAAACAAATATGAAATTGG - Intergenic
1089249484 11:117147282-117147304 CTCAAAAATAAAAATTAAACTGG - Intronic
1089864780 11:121622139-121622161 CTGAAAATTAAAGATGAGATGGG - Intronic
1090089869 11:123686201-123686223 TTTAAAAAGAGAAATGAAATAGG - Intergenic
1090135461 11:124193830-124193852 GTCAAAAATAAAAGAGAAATAGG - Intergenic
1090367831 11:126222681-126222703 TGCAAAAATTAGGATGAATTTGG - Intronic
1090697338 11:129261180-129261202 TTCAGAAATATTGTTGAAATTGG + Intronic
1091023010 11:132117945-132117967 TTCAAAACTGAAGAAGAACTTGG + Intronic
1091271537 11:134315566-134315588 TTTGAAAATTTAGATGAAATGGG - Intronic
1092015011 12:5151332-5151354 TTCCTAAATATAGATGATATGGG + Intergenic
1092299007 12:7227390-7227412 TGTAAAAATAAAGGAGAAATGGG + Intergenic
1092396363 12:8130535-8130557 TCAAAAAATAAAAATAAAATTGG - Intronic
1092642176 12:10525180-10525202 TTTGAAAATAAAAATGAAAAAGG + Intergenic
1092698759 12:11203388-11203410 TTAATAAATAGAGATGAAAGTGG + Intergenic
1092747290 12:11685742-11685764 TTCTGTAATAAAGATAAAATGGG + Intronic
1093002962 12:14019286-14019308 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1093026723 12:14252222-14252244 ATAAAAAATAAAAATAAAATGGG + Intergenic
1093074230 12:14740889-14740911 TTAAAAAAGAAAAAAGAAATTGG - Intergenic
1093122352 12:15286780-15286802 TTCAAAAATAAAGACAGAGTAGG + Intronic
1093326027 12:17775019-17775041 ATGAAAAATAAAAATGAAACAGG - Intergenic
1093467717 12:19467253-19467275 TTCAAAAATAAAAACAAAACAGG + Intronic
1093501754 12:19820927-19820949 TTTAAAAATAAATATTAAAGAGG + Intergenic
1093508761 12:19902036-19902058 CTCAAAAAGAAAGAGGAAATAGG - Intergenic
1093612271 12:21175788-21175810 ATCATAAATAAAGATTAAAAAGG - Intronic
1093811881 12:23501868-23501890 CTCAAAAAAAAAAATAAAATAGG - Intergenic
1093949459 12:25148224-25148246 TACAAAAATAAAGAGGATAGAGG - Intronic
1094086522 12:26598570-26598592 GTCAAACATAAACATGAAAAAGG + Intronic
1094292599 12:28869058-28869080 GTCAAAATAAAGGATGAAATTGG - Intergenic
1094428976 12:30346008-30346030 TTCCAAAAGAAAGACGGAATGGG + Intergenic
1094782585 12:33809296-33809318 TTAAAAAAAACAGATAAAATAGG + Intergenic
1095216116 12:39550554-39550576 ATCAACAATGAAGAAGAAATTGG + Exonic
1095435114 12:42178605-42178627 TTAAAAAATAAAAATGAAAATGG - Intronic
1095829325 12:46567601-46567623 CACAAAAGTAAACATGAAATTGG - Intergenic
1095858965 12:46893313-46893335 TTATAATAAAAAGATGAAATAGG + Intergenic
1096147550 12:49289639-49289661 TCAAAAAATAAAAATAAAATAGG + Intergenic
1096198065 12:49661860-49661882 TTCAACAATGAAGATGGAAATGG - Intronic
1096340479 12:50794264-50794286 TTTAAAAATTAAGATGAAGTCGG + Intronic
1096362498 12:51000222-51000244 TTCAAAATTAAAAATGAATTGGG + Intronic
1096914460 12:55016952-55016974 TTCAAAAATAATTGTGAAACAGG - Intergenic
1097273132 12:57791312-57791334 TTCAAAAATAAAATTGAACCTGG - Intronic
1097374513 12:58825090-58825112 TCCAACAATAAAGATAAAATGGG + Intergenic
1097397160 12:59089653-59089675 TTCAAAAATTAAAATGTAAAAGG - Intergenic
1097638482 12:62150303-62150325 TTCAAAAATAGGAATGAGATAGG - Intronic
1097925146 12:65119032-65119054 TTCAAAAATATAGAATTAATTGG + Intronic
1097938185 12:65277006-65277028 TTTAAAAACAAAAATAAAATGGG - Intergenic
1098164811 12:67684000-67684022 TTAAAAAATAAAAATTTAATGGG + Intergenic
1098234944 12:68409456-68409478 TCCAAAAATAAATATGGTATAGG + Intergenic
1098390787 12:69967660-69967682 GCCAAAAATAAAAATAAAATAGG - Intergenic
1098711320 12:73766205-73766227 TTCAAAAAATAAAATAAAATCGG - Intergenic
1098822530 12:75251020-75251042 TACAAAAGTAAAAATGGAATAGG - Intergenic
1098970178 12:76846284-76846306 TATAAAAGTAAAGATAAAATAGG + Intronic
1098993167 12:77088604-77088626 TTCAAAAATCTAGATGAAATAGG + Intergenic
1099074837 12:78093739-78093761 TTTAAAATTAAAGATGATTTGGG - Intronic
1099117335 12:78643768-78643790 ATAAAATATAAAGGTGAAATGGG - Intergenic
1099139697 12:78956900-78956922 TTGAAAAAGAAAGATCAAATAGG + Intronic
1099182964 12:79488626-79488648 TTTAAAAATTACAATGAAATTGG + Intergenic
1099326808 12:81226863-81226885 TTAAAAACAAAAGATGTAATTGG - Intronic
1099328835 12:81255380-81255402 TTAAATAAAATAGATGAAATGGG + Exonic
1099441229 12:82702097-82702119 TTAAGAAATATAGTTGAAATTGG + Intronic
1099575083 12:84368744-84368766 TTCATAAAAAAAGATTATATTGG + Intergenic
1099625203 12:85063832-85063854 TGCAACAATATAGATAAAATTGG - Intronic
1099706059 12:86154227-86154249 CTCAAGAATAAGTATGAAATAGG + Intronic
1099925111 12:89007636-89007658 GTAAAAAATAAAGAGGAAAATGG - Intergenic
1100029776 12:90172122-90172144 TTCAAAAATACACTTGGAATTGG - Intergenic
1100747922 12:97665978-97666000 TACAAAAATATTGATGAAATGGG - Intergenic
1100881532 12:99023361-99023383 TTCAAGAATAAGAATGAAAAAGG - Intronic
1100963284 12:99986014-99986036 CTCCAAAATAGAGATGAAAATGG - Intergenic
1101049533 12:100846953-100846975 TTCAAAAATTAAGTAGAAGTTGG - Intronic
1101151527 12:101887143-101887165 TTCAAAAAAAAAAAAAAAATTGG + Intronic
1101187919 12:102300072-102300094 TTCATAAATCAAGGAGAAATAGG - Intergenic
1101258674 12:103006571-103006593 TAAAAGAAGAAAGATGAAATAGG + Intergenic
1101564511 12:105892956-105892978 AACAAAAATATAGATGAAAGAGG + Intergenic
1102074812 12:110051425-110051447 TTAAAAAAAAAAAATGAGATTGG - Intronic
1102511302 12:113417421-113417443 AATAAAAATAAAAATGAAATTGG + Intronic
1102822444 12:115919233-115919255 TTCTGAGATAAAGAAGAAATAGG - Intergenic
1102997050 12:117359343-117359365 TTCAGAACTGAAGATAAAATAGG - Intronic
1103168071 12:118787931-118787953 TTCAAAAATAATGGGGAAATGGG - Intergenic
1103213007 12:119180004-119180026 TTAAAAAACAAAGAAGAAACGGG + Intronic
1103364551 12:120371692-120371714 TTAAAAAAAAAAAAGGAAATGGG + Intergenic
1103399590 12:120634224-120634246 TTTTAAAATAAAAATGAAAAGGG - Intergenic
1103424143 12:120816972-120816994 TTGAAAAATAAAAATTAATTTGG - Intronic
1103541709 12:121670807-121670829 TTAAAAAATAATAATAAAATAGG + Intronic
1103692256 12:122784672-122784694 TACAAAAATAAAAATTAACTGGG + Intronic
1104112860 12:125720010-125720032 TGCAAAAGAAAAGCTGAAATTGG + Intergenic
1104627619 12:130371961-130371983 CTCAAAAATAAAGTTAATATAGG - Exonic
1104672911 12:130692694-130692716 TTAAAAACTAAACATGGAATGGG + Intronic
1104982506 12:132580386-132580408 TTTAAAAATACTGGTGAAATTGG - Intronic
1105057746 12:133118238-133118260 TTCAAAAAGGAAGGTGAAGTTGG - Exonic
1105366033 13:19765993-19766015 TTCAAATATAAATATAAAATAGG + Intronic
1105377029 13:19855200-19855222 TTTAAAAATAATGATAAAAAAGG + Intronic
1105505101 13:21003001-21003023 TTCAAATTTTAAGATAAAATAGG - Intronic
1105507373 13:21022029-21022051 GTGAAATAGAAAGATGAAATAGG + Intronic
1105614250 13:21998259-21998281 TTCAAAAAGAAAAATGAAGGTGG + Intergenic
1105763618 13:23536093-23536115 TTGAAAATGAAAGACGAAATTGG - Intergenic
1106092271 13:26607309-26607331 ATTAAAAATAAAGATCTAATTGG + Intronic
1106301239 13:28468053-28468075 TTCAGAAAAAAAGATGAGACAGG - Intronic
1106395327 13:29374595-29374617 TTTATAAATGAAGATGAAATAGG + Intronic
1106447162 13:29846510-29846532 TTCAAAAATAAATTTTAAATGGG + Intronic
1106449070 13:29863497-29863519 CTCAAAAAAAAAAAAGAAATGGG + Intergenic
1106586739 13:31063742-31063764 TTCAAAAATAAACAAGTAAATGG + Intergenic
1106875616 13:34069057-34069079 CTCAAAAATAAAAATTATATAGG - Intergenic
1106932996 13:34687395-34687417 TTAAAAAAAAAAGCTGAAAGTGG - Intergenic
1107116440 13:36751820-36751842 TGCAAAAGTAAATATTAAATAGG + Intergenic
1107249576 13:38342484-38342506 TTCAGAAATCAAGATAAAAGTGG + Intergenic
1107567068 13:41615679-41615701 TTTTACAATAAAGATGAATTAGG - Intronic
1107730884 13:43347383-43347405 TTCAGAAATGAAGATGAAATTGG - Intronic
1108228209 13:48312209-48312231 TTTAAATATAAAAAAGAAATAGG - Intronic
1108235656 13:48402055-48402077 TTTAAACATTAAGATGAAAAAGG + Intronic
1108286314 13:48911936-48911958 TTCAAAAATAAAAGTGAAATAGG - Intergenic
1108315172 13:49229945-49229967 TTCTTAAATAAAGATGAAAATGG + Intergenic
1108450027 13:50552160-50552182 TTCAAAAAAAAAAATACAATTGG + Intronic
1108686557 13:52824956-52824978 TGCAAAAATGAAAATGCAATGGG - Intergenic
1109081627 13:57909877-57909899 TTTAAAAATCAAGATTAAAATGG - Intergenic
1109084618 13:57953995-57954017 TAGAAAAATTAAGGTGAAATGGG + Intergenic
1109103693 13:58221198-58221220 TTCAAGAAGAAAGAAGAAAAAGG - Intergenic
1109153704 13:58877517-58877539 TTTAAAACTACAGATAAAATAGG + Intergenic
1109179275 13:59193838-59193860 GGCAAAAAAAAAAATGAAATTGG - Intergenic
1109371780 13:61431118-61431140 TTCAAAAAAATAGACAAAATAGG - Intergenic
1109486068 13:63021638-63021660 TGCAACAATAAAGATGAAACTGG - Intergenic
1109578634 13:64295969-64295991 TTGTAAAAGAAAGAGGAAATTGG + Intergenic
1109579555 13:64309388-64309410 TATAAAAATAAGGATCAAATGGG + Intergenic
1109706067 13:66094418-66094440 TTCCAAAATAGTGATTAAATAGG + Intergenic
1109770784 13:66969803-66969825 TTCATATATAAATCTGAAATGGG + Intronic
1109783575 13:67144825-67144847 TACAAAAAGCAAGATGAATTGGG + Intronic
1109864835 13:68249389-68249411 TTTTAAAATAAAAATGAAAAGGG + Intergenic
1109875796 13:68403120-68403142 TTCAAATATAAACATGGAAGAGG + Intergenic
1109912786 13:68937757-68937779 TTCAAGAATGAAGATAAAATAGG - Intergenic
1109940384 13:69355811-69355833 TTAAAAAATATGGGTGAAATGGG + Intergenic
1109984007 13:69951616-69951638 CTCAAGAATAAAGAGGAAGTGGG - Intronic
1109994426 13:70105145-70105167 TCCAACAATAAAGATGATTTTGG + Intronic
1110072403 13:71193581-71193603 TTTAAAAATAAGTATGAAAGTGG + Intergenic
1110082146 13:71327894-71327916 TTCACAAATAAAAATATAATGGG - Intergenic
1110147879 13:72214996-72215018 TACTAAAATAAAAATGAATTTGG + Intergenic
1110191719 13:72737649-72737671 TACAAAAAAAAGGATGAAAAGGG - Intronic
1110244558 13:73307350-73307372 GGAAAAAATAGAGATGAAATGGG - Intergenic
1110401032 13:75092451-75092473 TTCACAAATAAAAAGAAAATGGG + Intergenic
1110426919 13:75377964-75377986 TTCAAATATAAACATGATTTGGG + Intronic
1110668715 13:78150117-78150139 TTCAGAAAAAAAGACAAAATTGG + Intergenic
1110726124 13:78826340-78826362 TTAAAAAATAAAAATGAAAAAGG - Intergenic
1110731893 13:78888192-78888214 TTCAAAAATTAAAATGAATTAGG + Intergenic
1110875294 13:80502205-80502227 TTCAATAACAAAAATTAAATGGG + Intergenic
1111254962 13:85654571-85654593 AGTAAAAATAAAAATGAAATAGG + Intergenic
1111364231 13:87220870-87220892 TTCTAAAATAAAGACCAACTAGG + Intergenic
1111484864 13:88883511-88883533 TTTACAAATAAAAATGAAACTGG - Intergenic
1111511734 13:89274204-89274226 TACAAAAATAAAAATAAAATAGG - Intergenic
1111530526 13:89531191-89531213 TTTAAAAATGTAGATAAAATAGG + Intergenic
1111728272 13:92040574-92040596 TTCAAAACCAAAGGAGAAATAGG - Intronic
1111864269 13:93749055-93749077 TTCAGAAATGAAAAAGAAATAGG - Intronic
1111881236 13:93959803-93959825 TTCTAAAATAAAGATAAGACTGG - Intronic
1112002115 13:95220482-95220504 TTCAAAGATAATCTTGAAATGGG - Intronic
1112209351 13:97359991-97360013 TTTAGAAATAAAGTTGAAAATGG - Intronic
1112463993 13:99627237-99627259 ATCAAAAATAAAGACGAGAAAGG - Intronic
1112795200 13:103049248-103049270 TTCAAAGATTATCATGAAATGGG + Intronic
1112834391 13:103496069-103496091 TTAAAATATAAAAATCAAATTGG - Intergenic
1112834406 13:103496467-103496489 TGAAAAAATAAATCTGAAATTGG + Intergenic
1112942294 13:104878430-104878452 TTAAAAAATGAGGATGCAATAGG - Intergenic
1113526633 13:110984246-110984268 TAAACAAATGAAGATGAAATTGG - Intergenic
1113949580 13:114064589-114064611 TTCCAAAAGAAAAATGAAACCGG + Intronic
1114310965 14:21466776-21466798 CACAAAAATCAATATGAAATGGG + Intronic
1114516659 14:23304036-23304058 TTAAAAAAAAAAAATGAAAGGGG - Intronic
1114518422 14:23317140-23317162 TTTAAAAATAAATATGTAATGGG + Intronic
1114589065 14:23842990-23843012 TTCCATAATAAAGTGGAAATGGG + Intergenic
1114837297 14:26218143-26218165 TTGAAAAAAAAAAATGAAATCGG + Intergenic
1114938140 14:27570809-27570831 TTCCAAGATAAAGATATAATGGG - Intergenic
1115079186 14:29429914-29429936 TTCAAAAATAAAAACAAAATAGG - Intergenic
1115128870 14:30028686-30028708 AACAAAAAGAAAGTTGAAATAGG - Intronic
1115622657 14:35155263-35155285 TTCAAAAATAACTGGGAAATAGG + Intronic
1115793627 14:36907894-36907916 TTTTTAAATAAAGAAGAAATCGG - Intronic
1116063828 14:39957780-39957802 TTTAAAAATATAAATTAAATGGG + Intergenic
1116157651 14:41228396-41228418 TGCAGAAATAAAGAAGAAATTGG - Intergenic
1116269462 14:42742509-42742531 TTGAAAAATCTAGAAGAAATGGG + Intergenic
1116347860 14:43819115-43819137 TTAAAAAATCAAGATGTATTAGG + Intergenic
1116443642 14:44983203-44983225 TTCCTAACTAAAGATTAAATGGG + Intronic
1116611343 14:47076655-47076677 TTCAAATATGTAGATAAAATAGG - Intronic
1116646503 14:47535687-47535709 GACACAAATAAACATGAAATAGG + Intronic
1116668802 14:47814590-47814612 TTTAAAAAGATAGATAAAATTGG - Intergenic
1116882011 14:50179979-50180001 ATAAAAAATAAAGATGAATCTGG - Intronic
1116929252 14:50673490-50673512 TTTAAAAATAAAGTTGAAAGTGG - Intergenic
1116932767 14:50706253-50706275 TCAAAAAATGAAGGTGAAATAGG - Intergenic
1117021620 14:51576473-51576495 TTCAAAAGAAGAGATGAGATAGG - Intronic
1117583929 14:57180805-57180827 TGCAACAAAATAGATGAAATCGG + Intergenic
1117860123 14:60081568-60081590 TTAAAAAATAAAGGTTAAAATGG - Intergenic
1117873849 14:60229653-60229675 TTCAATAGTTTAGATGAAATGGG - Intergenic
1118008756 14:61588980-61589002 TTAAAAAGTAAAGAATAAATCGG + Intronic
1118215088 14:63801374-63801396 TTTAAAAAAAAAGATAAACTGGG + Intergenic
1118781517 14:69011642-69011664 TTCAAAATTAAAGAGAAAATTGG - Intergenic
1118795986 14:69144574-69144596 TTAAAAAAAAAAGATTAAAGGGG + Intronic
1119067552 14:71545021-71545043 TACAAAAATAAAAATTAACTGGG - Intronic
1119208392 14:72811686-72811708 TTCAAATATAAACAAGACATAGG + Intronic
1119215890 14:72868805-72868827 TTAGAAAATAAAAATGAGATAGG - Intronic
1119229173 14:72966985-72967007 TTCAAAAAAAAAAAAAAAATTGG + Intergenic
1119310070 14:73638630-73638652 TCCAACAATAAAAAGGAAATGGG - Intergenic
1119621405 14:76134633-76134655 TTAAAAAAAAAAAATGAAAAAGG - Intergenic
1119745193 14:77038888-77038910 TTCAAAGAGAAGGATGAAAAGGG - Intergenic
1119785600 14:77311310-77311332 TTAAAAAAGAAAAAAGAAATAGG - Intronic
1119838002 14:77768674-77768696 TTCAAAAAGAATAATTAAATCGG - Intronic
1119915243 14:78393553-78393575 TTGAAAAAGAAAAATGAAGTAGG - Intronic
1120087392 14:80288991-80289013 ATCAAACATAAACATAAAATTGG + Intronic
1120114532 14:80598670-80598692 TTTAAAAATTAAGAATAAATTGG + Intronic
1120132217 14:80821671-80821693 TTAAAAAAAAAAAATTAAATGGG - Intronic
1120271284 14:82316776-82316798 TTTAAAAAATAAGATGAATTTGG - Intergenic
1120321494 14:82967573-82967595 ATCAAAATGAAAGATGAAAAAGG + Intergenic
1121593895 14:95143950-95143972 TTTAAAAATGAAAATGAAAGTGG + Intronic
1121986242 14:98508949-98508971 TTCAAAAACAAAGAGGGAAGAGG - Intergenic
1122022490 14:98850615-98850637 TGCAAAAAGAAATATGAAACAGG + Intergenic
1122524980 14:102375343-102375365 CTCAAAAAAAAAGAAGAAAGGGG + Intronic
1122639181 14:103147363-103147385 TTAAATAATAAAGATCAATTTGG + Intergenic
1122808418 14:104274482-104274504 TTTGAAATTTAAGATGAAATGGG - Intergenic
1122830225 14:104392366-104392388 CCCAAATCTAAAGATGAAATTGG - Intergenic
1202938506 14_KI270725v1_random:117589-117611 TTGAACAATAAATATGATATAGG + Intergenic
1123394690 15:19920302-19920324 TTGAACAATAAATATGATATAGG - Intergenic
1124143746 15:27101488-27101510 TTGAAAAAGAAGAATGAAATTGG + Intronic
1124384996 15:29200139-29200161 TTGAAAAATAAGAATTAAATGGG - Intronic
1124391718 15:29264798-29264820 CTCAAAAATAATGATAATATAGG + Intronic
1124401014 15:29347469-29347491 TTTAAAAATTAAGATGCCATAGG - Intronic
1124784769 15:32669273-32669295 TTCAGAAAGGAAGATGAAGTGGG + Intronic
1124936893 15:34181284-34181306 TTCTAAAATAAAAATAAGATAGG - Intronic
1125082950 15:35697023-35697045 GTTAAAAATAAAAATGAAAATGG + Intergenic
1125138378 15:36371361-36371383 TTAAAAAAGAAAGAAGAAAAGGG + Intergenic
1125672275 15:41482463-41482485 TTTAAACATAAAAATGAACTTGG + Exonic
1125821656 15:42637078-42637100 TTAAAAAAAAAAAAAGAAATTGG + Intronic
1125951580 15:43757138-43757160 TTTAAAAATATAGATGAGCTGGG + Intronic
1126037407 15:44559408-44559430 CTCAAAAAAAAAAATAAAATAGG + Intronic
1126204600 15:46031011-46031033 TTCAAAAATCAACTTAAAATGGG - Intergenic
1126305789 15:47255292-47255314 TACAAAATTAAAGGTGAAAAAGG - Intronic
1126463344 15:48937224-48937246 TACAAAAATAAAAATAAAAAAGG - Intronic
1127049249 15:55063974-55063996 CTCAAAAATGAAGCTGAAGTGGG + Intergenic
1127192336 15:56543825-56543847 AACAAAAATAAAAATGACATTGG - Intergenic
1127401905 15:58596341-58596363 TTCAAAAATAAATTTGGAATGGG + Exonic
1127430375 15:58900987-58901009 TTTAAAAATAAAATTAAAATTGG + Intronic
1127494443 15:59496768-59496790 TTGAAAAAAAAGGATGAAGTTGG - Intronic
1127593248 15:60449504-60449526 TGCAAAAATAAAGATGATCAGGG - Exonic
1127776580 15:62268727-62268749 TAGAAAAGTAAACATGAAATAGG + Intergenic
1128117553 15:65120315-65120337 TACAAAAATAAAAAAAAAATTGG - Intronic
1128434672 15:67634784-67634806 TTCAAAAATAATGACACAATAGG - Intronic
1128572824 15:68747730-68747752 TTCTAAAACTTAGATGAAATGGG + Intergenic
1128721439 15:69953093-69953115 ATGAAAATTAAAGAAGAAATGGG + Intergenic
1128800473 15:70493758-70493780 TTGAAAACTAAAGATGAGAGAGG - Intergenic
1129291633 15:74572640-74572662 TTCCAAAATAAAGAGGGAATCGG - Intronic
1129755982 15:78099311-78099333 CTCAAAAATAAAAATAAAAATGG - Intronic
1129782049 15:78278979-78279001 TTCAAAAAAAAAGAATAAACAGG + Intronic
1129905830 15:79186558-79186580 AGCAAAAATAAAGAAGAAATGGG - Intergenic
1129947411 15:79551296-79551318 CTCAAAAATAAAGAGGAAAGCGG + Intergenic
1130023927 15:80254231-80254253 TTCAAAAATAAACAACAAACTGG + Intergenic
1130208687 15:81902469-81902491 TCCAAACATAGACATGAAATAGG + Intergenic
1130216643 15:81977905-81977927 TACAAGTATAAAAATGAAATTGG + Intergenic
1130262284 15:82365213-82365235 TTGAAAAATAAAGACAAAAAAGG - Intergenic
1130379393 15:83358674-83358696 TTCATAAATTAAGTTGAATTTGG + Intergenic
1130731332 15:86495853-86495875 TTCAGAGATACAGATCAAATAGG - Intronic
1131441427 15:92462449-92462471 TGCAAAAATAAAGAAGTATTTGG + Intronic
1131588078 15:93717642-93717664 TTCAAAAATAAGGTTGTCATGGG - Intergenic
1131885662 15:96909401-96909423 TACAAATATAAAGATTAAAATGG + Intergenic
1131921897 15:97337144-97337166 TTAAAAAATAAAAATATAATGGG - Intergenic
1131941686 15:97574008-97574030 CTCAAAAATAAAAATGGAAGAGG + Intergenic
1131990412 15:98088358-98088380 TTCAAAAATAAAGAAAAAATTGG + Intergenic
1132094689 15:98974078-98974100 TTGGAAAATATAGAAGAAATAGG + Intronic
1132115600 15:99133526-99133548 TTCAAAAAGAAATGGGAAATAGG + Exonic
1132780334 16:1620917-1620939 TGTAAAAAAAAAAATGAAATGGG - Intronic
1133074842 16:3271957-3271979 TTAAAAAATAAAAATAAAAAAGG + Intronic
1133539821 16:6739194-6739216 TTTAAAAATATAGAAGAAAATGG + Intronic
1133678525 16:8098589-8098611 TGCAAAAATAAAAATGCAAGAGG - Intergenic
1133864538 16:9630183-9630205 TTTAAAAAAAAACATGATATGGG + Intergenic
1133892077 16:9889214-9889236 TTCAACGATATAGATAAAATGGG - Intronic
1134258032 16:12627371-12627393 TATAAAAATAAAGATGATAGTGG + Intergenic
1134443303 16:14312177-14312199 TTAAAAAATAAATATAAAATAGG - Intergenic
1134577685 16:15346003-15346025 TAAAAAAAAAAAAATGAAATTGG - Intergenic
1134931299 16:18210050-18210072 CTCAAAAAAAAAAATGAAAATGG + Intergenic
1135715636 16:24763756-24763778 TACCAAAATAAAGATGAGAATGG - Intronic
1135720769 16:24816023-24816045 TTTAAAAATAAACATGAATCTGG + Intronic
1135820101 16:25677387-25677409 TCCAAGAATACAGATGAAATTGG - Intergenic
1135821301 16:25689021-25689043 TTCAAGAATAAAGTTTTAATAGG + Intergenic
1136697125 16:32092700-32092722 TTGAACAATAAATATGATATTGG + Intergenic
1136700783 16:32138718-32138740 TTGAACAATAAATATGATATAGG - Intergenic
1136750420 16:32630554-32630576 TCCAAAAGTAAAAATAAAATGGG - Intergenic
1136797624 16:33035991-33036013 TTGAACAATAAATATGATATTGG + Intergenic
1136945044 16:34639617-34639639 TTGAACAATAAATATGATATAGG - Intergenic
1136947983 16:34678765-34678787 TTGAACAATAAATATGATATAGG - Intergenic
1136955370 16:34778647-34778669 TTGAACAATAAATATGATATAGG - Intergenic
1136959096 16:34825149-34825171 TTGAACAATAAATATGATATAGG - Intergenic
1136967220 16:34928458-34928480 TTGAACAATAAATATGATATAGG - Intergenic
1137085022 16:36109397-36109419 TTGAACAATAAATATGATATAGG + Intergenic
1137092276 16:36208725-36208747 TTGAACAATAAATATGATATAGG - Intergenic
1137221557 16:46456878-46456900 TTGAACAATAAATATGATATAGG + Intergenic
1137266419 16:46872655-46872677 TTCAAAAACAAAGAAGAGACTGG + Intergenic
1137295710 16:47091481-47091503 TTAAAAAGTAAAAAAGAAATTGG + Intronic
1137647575 16:50089189-50089211 GTCAAGAATAGACATGAAATGGG - Intronic
1137659718 16:50194115-50194137 ATCAATAATCAAAATGAAATAGG - Intronic
1137660174 16:50198727-50198749 TTGAAAACTAAAGATGAGTTTGG + Intronic
1137786647 16:51142869-51142891 TTTAAAAATAAACATGCCATGGG - Intronic
1138187049 16:54984891-54984913 CTGAAAAATAAGGATGAGATGGG - Intergenic
1138252862 16:55518479-55518501 TTGAAAAATAAAAACAAAATTGG + Intronic
1138753337 16:59450953-59450975 TTCAAAAAAAATGATAAAAGAGG - Intergenic
1138759991 16:59532198-59532220 TTCACAAATAAATATGGAATGGG + Intergenic
1138851190 16:60631926-60631948 TTGGAAAATGAAGATTAAATTGG - Intergenic
1139067397 16:63334920-63334942 CACAAAAATAAATATGAAATAGG - Intergenic
1139782435 16:69363177-69363199 TTCATAAATAAAAATCAGATGGG + Intronic
1139895818 16:70287419-70287441 CTCAAAAAAAAAGTTGAAACAGG - Intronic
1140172372 16:72619148-72619170 TAAAAAAAAAAAGAAGAAATTGG + Intergenic
1140606495 16:76545689-76545711 TTCAAAAATAAAAAGGAGAAAGG + Intronic
1141176771 16:81725587-81725609 TTTAAAAATTAAGAAGAAATAGG + Intergenic
1141197013 16:81867695-81867717 TCCAAAAATAAAAAAGAAAAGGG - Intronic
1141244978 16:82297563-82297585 CTCAGAAATAAAGATTAAAGGGG - Intergenic
1203052551 16_KI270728v1_random:889758-889780 TCCAAAAGTAAAAATAAAATGGG - Intergenic
1203069269 16_KI270728v1_random:1050993-1051015 TTGAACAATAAATATGATATAGG + Intergenic
1142692518 17:1615409-1615431 TACAAAAATATAAATGAAAATGG - Intronic
1143342597 17:6225450-6225472 TTAATATATAAAGATGCAATCGG - Intergenic
1143435835 17:6924136-6924158 TTCAAAAATAAAGTAGGAAGGGG - Intronic
1143488579 17:7269852-7269874 TTCAAAAAAAGAGAAAAAATGGG + Intergenic
1143690467 17:8559775-8559797 TTCAAAAAAGAAACTGAAATTGG + Intronic
1143986853 17:10922052-10922074 TTCAAGAATTAAGATGAGAGTGG - Intergenic
1144095929 17:11900735-11900757 TTCAAATAAAAAGATTATATTGG + Intronic
1144537182 17:16102237-16102259 TTAAAAAAGTAAGAAGAAATTGG + Intronic
1145216677 17:21057709-21057731 GTCAAAAATAAAGTAGAATTGGG - Intergenic
1145324040 17:21783682-21783704 TTGAACAATAAATATGATATAGG + Intergenic
1145326571 17:21835113-21835135 TTTAACAATAAATATGATATAGG - Intergenic
1145736863 17:27239114-27239136 TTCAAAACCAAAGATTAAAAGGG + Intergenic
1145820514 17:27830358-27830380 GTCAAAAATAAATGTGACATGGG + Intronic
1145821427 17:27839464-27839486 GTCAAAAATAAAAGTGACATGGG - Intronic
1146125076 17:30224990-30225012 TTAAAAAATTAAGAAGAACTAGG - Intronic
1146155447 17:30520281-30520303 TTCTAAAATGTAGAAGAAATTGG - Intronic
1146552744 17:33795739-33795761 TTCAAAACTAAAGATTAACAGGG - Intronic
1146573412 17:33971682-33971704 TTCACAAATACAGATGAAATAGG - Intronic
1147151009 17:38513815-38513837 TTCAAAAATAAAGTAGGAATAGG + Intergenic
1147520305 17:41165548-41165570 TTAAAAAATTAATAAGAAATAGG - Intergenic
1147678061 17:42220787-42220809 TTTAAAAATTATTATGAAATAGG + Intronic
1147840449 17:43367965-43367987 TTGGAATAGAAAGATGAAATAGG - Intergenic
1148126527 17:45240340-45240362 TTAAAAAATAAAGAAAAAGTAGG + Intronic
1148452460 17:47788738-47788760 TTGAAAAAGAAACATGAAGTTGG + Intergenic
1148653422 17:49265967-49265989 TCCAAAAACAAAAAAGAAATAGG - Intergenic
1148910851 17:50941860-50941882 TTAAAAAATAAAAATAAAAGAGG - Intergenic
1149155722 17:53628005-53628027 TTAATATATAAAGATGCAATTGG - Intergenic
1149157733 17:53653102-53653124 TTAGAAAGTAAAAATGAAATCGG - Intergenic
1149628693 17:58100948-58100970 TTGAAAAATAATGATAAAGTTGG - Intergenic
1149792120 17:59488437-59488459 TTCAAAAATCAAAACTAAATAGG - Intergenic
1150183690 17:63156852-63156874 TACAAAAATAAAAATTAAACAGG - Intronic
1152435977 17:80276398-80276420 TTAAAAAATAAATAAAAAATAGG - Intronic
1152548602 17:81017553-81017575 TAAAAAAATAAAAATAAAATAGG - Intergenic
1203182824 17_KI270729v1_random:80247-80269 TTGAACAATAAATATGATATAGG - Intergenic
1153044206 18:840860-840882 TTCAAAAAAAAAACTGAAAAGGG - Intergenic
1153166862 18:2271351-2271373 TTCAAAATAAAAGATCATATAGG - Intergenic
1153296918 18:3555426-3555448 TTAAAAAATAATGATAAAAATGG + Intronic
1153500765 18:5747213-5747235 TTGAAATTTAAAGGTGAAATTGG + Intergenic
1153995510 18:10438134-10438156 TTCTAAAACACTGATGAAATTGG - Intergenic
1154045276 18:10898418-10898440 CTCAAAAAAAAAAAGGAAATAGG + Intronic
1154094447 18:11398963-11398985 TACACATATAAAGATGAAAAGGG - Intergenic
1154212859 18:12394952-12394974 AAAAAAAAAAAAGATGAAATAGG - Intergenic
1154516444 18:15172069-15172091 TTGAACAATAAATATGATATAGG + Intergenic
1154981620 18:21506898-21506920 TATAAAAATAAAGATGAATTTGG - Intronic
1155080485 18:22405422-22405444 ATTAAAAATAAAGAGGAAAAGGG + Intergenic
1155175373 18:23297219-23297241 TTTAAAAATAAAAATGAGAAAGG + Exonic
1155327927 18:24684260-24684282 TTCAAAAATGTGGAAGAAATGGG - Intergenic
1155557672 18:27038919-27038941 TTCAAAAAGCAAAATGCAATAGG - Intronic
1155650825 18:28139401-28139423 TTAAAAGAAAAAGAAGAAATTGG - Intronic
1155751237 18:29424412-29424434 TTCAAAAATTAAGATAAGGTTGG - Intergenic
1155856686 18:30843606-30843628 GTCAAAGAAAAAGAAGAAATTGG - Intergenic
1156070477 18:33201351-33201373 ATCAAATGTAAAGATGAAAGGGG - Intronic
1156117241 18:33800591-33800613 TTTTAAAATAAAGAACAAATAGG - Intergenic
1156163279 18:34386241-34386263 TCAAAAAATAAAAATAAAATAGG - Intergenic
1156190263 18:34710988-34711010 TTAAAAAATATAGATAAAACCGG - Intronic
1156274187 18:35566414-35566436 TTGAAAAATAAGGATAAAATTGG + Intergenic
1156389490 18:36637282-36637304 AACAAAAACAAAAATGAAATAGG - Intronic
1156580826 18:38372961-38372983 ATCAAAAATCAAGATGAAGAGGG + Intergenic
1156592096 18:38501952-38501974 TTAAAAAATAAAAATGAGACCGG + Intergenic
1156597482 18:38564172-38564194 GACAAAAATAAAGATGAGTTTGG + Intergenic
1156602914 18:38631175-38631197 ATCACAAATAAAGAAAAAATGGG - Intergenic
1156681556 18:39595297-39595319 CTATAAAATAAAGATGATATTGG + Intergenic
1156740436 18:40320642-40320664 TACAAATATAAAGATGATAAAGG + Intergenic
1156776639 18:40797244-40797266 TTGAACAAAAAAGATGAAAAGGG + Intergenic
1156842997 18:41631722-41631744 ATTAAAAATAAGGATGAAATAGG + Intergenic
1157089516 18:44620019-44620041 GTCAAAGATATAGATAAAATGGG + Intergenic
1157102306 18:44742129-44742151 TTCAAAAATTAAAATGTAAATGG - Intronic
1157189640 18:45570003-45570025 ATCAAAAATGAAGAAAAAATTGG + Intronic
1157278223 18:46327350-46327372 TTCAAAAATAAAAGTGAAAAAGG - Intronic
1157793584 18:50555587-50555609 TTTAAAAAGAACAATGAAATAGG - Intergenic
1157825189 18:50806104-50806126 TACAAAAATATAAAAGAAATGGG + Intronic
1157928798 18:51796245-51796267 TTCACAAAAAAAAATGCAATTGG - Intergenic
1158328118 18:56331967-56331989 TTCAAAAATGAAGATGCCAGTGG + Intergenic
1158600137 18:58849456-58849478 TTCAAAAAAAAAAAAAAAATTGG + Intergenic
1158971487 18:62671778-62671800 TTCAAAAATTAGGAAGATATGGG - Intergenic
1159093687 18:63877391-63877413 ATCAGAAATTAAGATGACATTGG + Intronic
1159339070 18:67110959-67110981 TTCAAAAATAAAAATTATAAGGG - Intergenic
1159355458 18:67333897-67333919 TTCTGACATAAAGAAGAAATTGG + Intergenic
1159372485 18:67546289-67546311 CTCAAAAAAAAAGAAGAAAAAGG - Intergenic
1159550233 18:69887018-69887040 TTAAAAAAGAGAGATGAGATGGG - Intronic
1159772997 18:72570207-72570229 ATCAAAAATACATATTAAATAGG - Intronic
1160355470 18:78224726-78224748 TTTAAAAATAGAGAGGATATTGG - Intergenic
1160623803 18:80189257-80189279 TTTAAAAAGAAAGAAGAAAACGG - Intronic
1161792364 19:6368044-6368066 TTAAAAAACAAAATTGAAATTGG + Intronic
1161910973 19:7193597-7193619 GTAAAAAATAAAAATAAAATAGG - Intronic
1161913778 19:7213987-7214009 CTCAAAAAAAAAAAGGAAATGGG + Intronic
1162210917 19:9091315-9091337 TTAAAAAAAAAAAAAGAAATGGG - Intergenic
1163010487 19:14422463-14422485 AACAAAAATAAAGAAGAAAGAGG + Intergenic
1164100595 19:22051519-22051541 TTTAAAAAGAAAGAAGAAATAGG - Intergenic
1164130114 19:22354407-22354429 TTTAAAAATAAAGAAAAAACAGG + Intergenic
1164423746 19:28121174-28121196 TTCAAAAATCTAATTGAAATTGG + Intergenic
1164426529 19:28146725-28146747 TTCCAAAATAAAGAAGTATTGGG - Intergenic
1164842656 19:31405089-31405111 TCCAGAAATAAACATAAAATGGG - Intergenic
1165643498 19:37411049-37411071 CTCAAAAATAAGAATCAAATGGG - Intergenic
1166160910 19:40952325-40952347 TTAAAAAAAAAAGTAGAAATAGG - Intergenic
1166761799 19:45228769-45228791 CTCAAAAATAAAAATAAAATAGG + Intronic
1166918972 19:46215451-46215473 TAAAAAAAAAAAGAAGAAATCGG + Intergenic
1166990011 19:46686649-46686671 CTCAAAAAAAAAAATAAAATAGG + Intronic
1167862861 19:52299008-52299030 TTTAAAAATACAGATGAAAATGG + Intronic
1168163336 19:54527840-54527862 TTCAAAAAAAAAAAAGAACTTGG + Intergenic
1168386583 19:55968438-55968460 TCAAAAAATAAAAATAAAATAGG + Intronic
1168442865 19:56386123-56386145 TTAAAAAATAAAAATAAAAGTGG + Intronic
1168488514 19:56786626-56786648 TCCAAAAATTTAGTTGAAATAGG + Intronic
1202668994 1_KI270709v1_random:32143-32165 TTGAACAATAAATATGATATTGG - Intergenic
1202690476 1_KI270712v1_random:84849-84871 TTCTAAAATAATTTTGAAATAGG - Intergenic
925212904 2:2065896-2065918 TTAAAACAGAAAGAAGAAATTGG + Intronic
925445259 2:3921791-3921813 TAGAAAAATAATTATGAAATGGG + Intergenic
925458554 2:4040670-4040692 TGTAAAAATAATGCTGAAATAGG + Intergenic
925557188 2:5144250-5144272 TTAAAAAAAAAAGATGAATGAGG - Intergenic
925577388 2:5374506-5374528 TACAAAGACAGAGATGAAATGGG + Intergenic
925790777 2:7485411-7485433 TTCAAAATTATAAATAAAATTGG + Intergenic
925842539 2:8006264-8006286 TTCAAAAATAAAGGAAAAGTGGG - Intergenic
926087639 2:10029950-10029972 TGGAAAAAAAAAGATAAAATGGG - Intergenic
926186986 2:10698262-10698284 CTCAAAAAAAGAGATGAGATGGG + Intergenic
926336759 2:11869067-11869089 TAAAAAAATAAAGATCAATTAGG + Intergenic
926359753 2:12075250-12075272 TTCAAAAATAATCTTGAAACTGG - Intergenic
926709664 2:15868623-15868645 TACATAAATAAAAATGAAATGGG + Intergenic
926807965 2:16729492-16729514 TTCAAGAAGGAAGAAGAAATGGG - Intergenic
926812922 2:16772455-16772477 GTAAAAAAAAAAAATGAAATGGG + Intergenic
926835701 2:17017441-17017463 TTCACATATAAAAATGAATTTGG - Intergenic
926916793 2:17900197-17900219 TACAAAAATTAAGAAAAAATAGG + Intronic
926930671 2:18037103-18037125 TTCAGAAATGAAGACTAAATAGG - Intronic
927252572 2:21010851-21010873 TACAACACTAAAGATAAAATTGG - Exonic
927334092 2:21900723-21900745 TTAAAAAATATTGATGAATTTGG - Intergenic
927360646 2:22228907-22228929 TTCAACAACACAGATGAAGTGGG + Intergenic
927397179 2:22666028-22666050 TTGAAAAATAAAAATAAAACTGG - Intergenic
927541356 2:23914355-23914377 TTGAAAAATAATAATAAAATAGG + Intronic
927608171 2:24507883-24507905 ATTAAAAAGAAAGAAGAAATTGG - Intronic
928354710 2:30600557-30600579 TTCAAAAATAAAAACAAATTGGG + Intronic
928417295 2:31106491-31106513 CTCAGAAATGAAGATGAAGTTGG - Intronic
928793060 2:34981597-34981619 TTAAAAAATAAAGATTGAAAGGG - Intergenic
929123795 2:38504499-38504521 TTCAGAAATACAGATGAGAAGGG - Intergenic
929329913 2:40669981-40670003 TTCAGAAATAAAGTTAAATTTGG + Intergenic
929330969 2:40680262-40680284 GTCAAAATCAAAGAAGAAATTGG - Intergenic
929370276 2:41215054-41215076 TTAAAAAATAAAGAACATATTGG - Intergenic
929503867 2:42513159-42513181 TGCCAACACAAAGATGAAATGGG - Intronic
929651114 2:43680548-43680570 TTCTAAAATAAAAATTAAAAAGG - Intronic
929731302 2:44495877-44495899 ATCACTAATAAAAATGAAATTGG - Intronic
930071674 2:47370573-47370595 TTCAAATAAAAAAATAAAATAGG - Intronic
930109465 2:47666233-47666255 TTCTTAAATAAAGGAGAAATTGG - Intergenic
930403053 2:50915467-50915489 TACAATAATGAGGATGAAATAGG - Intronic
930499105 2:52188851-52188873 CTCAAAAAAAAAAATAAAATTGG + Intergenic
930800679 2:55439482-55439504 TTTTAAAAAAAAGATCAAATTGG - Intergenic
930910659 2:56625614-56625636 TTGAAAAATAAAAATAAAAAAGG - Intergenic
931047536 2:58373276-58373298 ATCAAAAATAATGATGCAATTGG - Intergenic
931155875 2:59628913-59628935 TTCAAAAATATCGATGATAAAGG + Intergenic
931182867 2:59920688-59920710 TGGAAAAATAAAGATATAATAGG + Intergenic
931307732 2:61047834-61047856 TTTAAAGATATAGATAAAATAGG + Intronic
931338511 2:61374876-61374898 TTCAATAATAGAGAAGAACTAGG + Intronic
931634553 2:64329766-64329788 TTCAGAAATAAAGTTTAAATGGG - Intergenic
931716136 2:65030121-65030143 AACAAAAATAAAGAGGAAAGTGG - Intergenic
931909226 2:66877678-66877700 TTCAACAATATAGATGGATTAGG - Intergenic
932136100 2:69230165-69230187 TCAAAAAATAAAGACAAAATAGG - Intronic
932246284 2:70199442-70199464 TTCAAAAAAAAAAGTGAATTGGG - Intronic
932387581 2:71350904-71350926 TTAAAAAATAAAGATGATTTAGG + Intronic
932785713 2:74600825-74600847 TGCAAAAATAAAAGTGCAATGGG + Intronic
932857605 2:75253622-75253644 GTGAAAACTGAAGATGAAATGGG + Intergenic
932884146 2:75532840-75532862 TTGAAAACTAAAGACTAAATAGG + Intronic
933254649 2:80066932-80066954 TGCAAAAATATAGATGAATCTGG + Intronic
933396258 2:81735301-81735323 TTCAAAAATCAACTTGAACTTGG - Intergenic
933414911 2:81975249-81975271 GACAAAAATAAAGATGATAAAGG + Intergenic
933556927 2:83842227-83842249 TTCAAAGATAAAGATAAATTAGG + Intergenic
933559053 2:83869377-83869399 TTCCAATATACAGATGACATGGG + Intergenic
933561787 2:83896869-83896891 TTCAAAAACAAAGATAACTTTGG + Intergenic
933955939 2:87371156-87371178 TTCTAAAATAATTTTGAAATAGG + Intergenic
934068346 2:88360824-88360846 TTAAAAAAAAAAGATGGAAATGG + Intergenic
934240092 2:90263187-90263209 TTCTAAAATAATTTTGAAATAGG + Intergenic
934252292 2:90367724-90367746 TTGAACAATAAATATGATATTGG + Intergenic
934257150 2:91435221-91435243 TTGAACAATAAATATGATATTGG - Intergenic
934273100 2:91553564-91553586 TTCTAAAATAATTTTGAAATAGG - Intergenic
934324176 2:91995773-91995795 TTCTAAAATAATTTTGAAATAGG + Intergenic
934791567 2:97066825-97066847 TCCAACAATGAAGAAGAAATTGG - Intergenic
934814871 2:97315718-97315740 TCCAACAATGAAGAAGAAATTGG + Intergenic
934822824 2:97392765-97392787 TCCAACAATGAAGAAGAAATTGG - Intergenic
934908305 2:98226132-98226154 TTGAAAAAGAAAAATAAAATGGG + Intronic
935105228 2:100036638-100036660 TACAAAATTAAAGATAAACTAGG + Intronic
935158323 2:100504789-100504811 TTCAAAGATAGATATAAAATAGG + Intergenic
935431113 2:102976979-102977001 TTCTAAAATAAAGCTGCAATTGG - Intergenic
935443317 2:103128639-103128661 ATCAAAAATTAAAATGAAAAGGG - Intergenic
935448498 2:103182209-103182231 TTCAAAAAGAAAGAAGGAAGGGG + Intergenic
935507023 2:103917855-103917877 TTAATAAATAAAGGTGCAATGGG + Intergenic
935519282 2:104084007-104084029 TTTAAAAATAAGAATGAAGTTGG - Intergenic
935628516 2:105192088-105192110 TTTTAAAATAAAGTGGAAATGGG + Intergenic
935679567 2:105624264-105624286 TACCAACATAAAGATGGAATAGG - Intergenic
935793512 2:106616211-106616233 TTCAGCAATAAAAATGAAATGGG - Intergenic
935799789 2:106683367-106683389 TGAAAAAATAAAGAAGAAAGTGG - Intergenic
935805497 2:106743528-106743550 TTCATGATTAAAGGTGAAATTGG + Intergenic
936162517 2:110095253-110095275 TACAAAAATAAACATTAAAATGG - Intronic
936914864 2:117629999-117630021 TTCCAAGATAAAAATGGAATCGG - Intergenic
936995217 2:118406973-118406995 TTGAATAATAAAGATAAAAGTGG - Intergenic
937449031 2:121985194-121985216 TTTAAAAATGAAGGTGAAATAGG - Intergenic
937509676 2:122580822-122580844 TTGACAAATAAATATCAAATTGG + Intergenic
937641429 2:124216301-124216323 ATCAAAAATATATATGAAAAAGG + Intronic
937648640 2:124295711-124295733 TTTAGAAATAAACATAAAATAGG - Intronic
937837883 2:126492351-126492373 TTCAAAAGAAAAAATTAAATTGG + Intergenic
937920579 2:127126690-127126712 TTCAAAAAGGAAGAATAAATTGG - Intergenic
938183017 2:129201413-129201435 TTCAAAAATAAAAAAGGAATGGG + Intergenic
938516765 2:132017063-132017085 TTGAACAATAAATATGATATAGG + Intergenic
938965992 2:136389006-136389028 CTTAAAAAGAAAGGTGAAATAGG - Intergenic
939051104 2:137309408-137309430 TTTAAAAATAAATATCAAACTGG - Intronic
939296250 2:140268144-140268166 TTCTAAAATAGAAATAAAATAGG + Intronic
939336987 2:140842596-140842618 TAAAAAAAAAAAGATGAAATTGG - Intronic
939357128 2:141116633-141116655 TATAAAAATAAAGATGATACTGG - Intronic
939360469 2:141165175-141165197 TTCAAAAATAATCACAAAATCGG + Intronic
939554686 2:143660196-143660218 TTAAAAAAAACAGATCAAATTGG - Intronic
939600070 2:144177826-144177848 TTAAAAAATAAAACTGAAACAGG + Intronic
939653919 2:144799032-144799054 TTCCAAAATAAAAAGGAGATAGG - Intergenic
939724247 2:145695572-145695594 TTCAAAAAGAAGAATGAATTTGG - Intergenic
939735978 2:145845852-145845874 TTCAAAGACAAACATCAAATAGG - Intergenic
939865073 2:147463379-147463401 TTCAAAATGAAAGAAGAATTAGG - Intergenic
940089881 2:149903113-149903135 AGCAAAAATAAATATGAAACTGG + Intergenic
940196279 2:151097787-151097809 TTCAAAAGTAAAAATGATACAGG + Intergenic
940220776 2:151349105-151349127 CTCAAAAAAAAAAAAGAAATAGG + Intergenic
940276030 2:151941576-151941598 TTCAAAAATTGAGACGAAGTTGG - Intronic
940385173 2:153063267-153063289 TTCAAAAATAAAGTGGACAAAGG - Intergenic
940517870 2:154703796-154703818 ATTAAAAATAAAGTTCAAATTGG - Intronic
940685319 2:156842331-156842353 TTTAAATATAATGATGATATTGG + Intergenic
940744381 2:157550824-157550846 TTCAAAAACCAAGCTCAAATTGG + Intronic
940758733 2:157713833-157713855 TTCACAAATGAAGTTAAAATAGG - Intergenic
940875895 2:158896695-158896717 TTTAGAAATAATCATGAAATGGG + Intergenic
941014869 2:160344145-160344167 TTTAAAAGTCAAGATGAAATCGG + Intronic
941048691 2:160705927-160705949 TTCAATAATAAAAATGCAAATGG - Intergenic
941238145 2:163001508-163001530 CTCAAAAAAAAAAATTAAATTGG + Intergenic
941242622 2:163058616-163058638 TTCAAAAATAACAATCAATTTGG + Intergenic
941318741 2:164028365-164028387 TGCAACAACATAGATGAAATTGG + Intergenic
941403466 2:165060423-165060445 TTCAAAACTAAATTTGCAATTGG + Intergenic
941574240 2:167210946-167210968 TTCAAATATAAAGAGGGAATTGG - Intronic
941655291 2:168137233-168137255 TTAAAATATAAGGATCAAATTGG + Intronic
941700526 2:168599818-168599840 TCCAAATATAAAGAGGAAGTAGG + Intronic
941796831 2:169608487-169608509 CTCAAAAAAAAAGATGAGAGGGG + Intronic
941982493 2:171474454-171474476 CTAAAAAAGATAGATGAAATAGG - Intronic
942007640 2:171721540-171721562 TTTAAAAATACAGATTACATAGG - Intronic
942468745 2:176237604-176237626 TGCAACAACACAGATGAAATTGG - Intergenic
942704375 2:178752867-178752889 TGCAAACATAAAGTTGAATTTGG + Intronic
943069258 2:183121674-183121696 TTCAAAAAAAAAAATGAGTTGGG + Intronic
943082593 2:183273642-183273664 TTCAACAATAAAAAGGAAAGGGG - Intergenic
943741353 2:191413075-191413097 CTCAAAAATATATTTGAAATAGG + Intronic
943750888 2:191508332-191508354 TTTTGGAATAAAGATGAAATGGG - Intergenic
943875568 2:193063025-193063047 TTTAATACTAAAGATAAAATTGG - Intergenic
944040961 2:195354495-195354517 TTTAAAAAGAAAGAAGAAAATGG + Intergenic
944081961 2:195797997-195798019 TTCAAAAATCTGGAGGAAATAGG + Intronic
944100348 2:196019688-196019710 TTTAAAAATAAAAATAAAAGAGG - Intronic
944561651 2:200945197-200945219 ATCAAAAACAAATATGACATAGG - Intronic
944736163 2:202568454-202568476 CTCAAAAATAAAAATAAAACTGG + Intergenic
945023224 2:205594928-205594950 TTAAAAAATAAAAATAAAATTGG - Intronic
945152437 2:206805427-206805449 TACAAAAATGAAGAGAAAATGGG - Intergenic
945202962 2:207302877-207302899 TTCTAAAATTCATATGAAATTGG + Intergenic
945331483 2:208544653-208544675 GTAAAAAATAAAAATGTAATAGG + Intronic
945336953 2:208603786-208603808 TTAAAAAATAAAGAGAATATCGG + Intronic
945458025 2:210071251-210071273 TAAAAAAATAAAAATGAAAAGGG - Intronic
946094837 2:217264945-217264967 TATAAAAATAAAAATGAAAGTGG - Intergenic
946114114 2:217446703-217446725 ATCAAACATGAAGATTAAATAGG + Intronic
946524104 2:220499063-220499085 TTCAAAAATGTAGATAAAATAGG - Intergenic
946669164 2:222084368-222084390 TCCAAAACCAAAGATGGAATAGG - Intergenic
946781810 2:223199084-223199106 TTAAAAAATAAAGATGTCATGGG + Intergenic
946937718 2:224738696-224738718 TTCAAAAATAATGTTTAATTTGG + Intergenic
947043958 2:225956597-225956619 TTCAAAAATAAAAGTTACATTGG + Intergenic
947066385 2:226230607-226230629 TTCAACAACATAGATGAATTTGG + Intergenic
947183625 2:227434633-227434655 TTCAAATGTAAATAGGAAATGGG - Intergenic
948405397 2:237713842-237713864 TTCACAAATAATGAAGAAAGAGG - Intronic
948724562 2:239925658-239925680 TTAAAAAATATACATAAAATTGG + Intronic
1169318619 20:4612939-4612961 TTCAAAAATAAAGAGTAAGTGGG + Intergenic
1169328634 20:4698585-4698607 TTAAAAAATAAAAATAAAAAAGG + Intronic
1169536500 20:6548318-6548340 TTTCAAAATATAGAAGAAATGGG + Intergenic
1169612789 20:7401642-7401664 TTCTAAATTAAAGATAAAATAGG - Intergenic
1169850174 20:10040007-10040029 TTAAAAAATCAAGGTAAAATTGG + Intronic
1169948495 20:11015242-11015264 TTCAAAAATAGAGATGACTTGGG - Intergenic
1170031540 20:11949255-11949277 TTCTAAAATAAAGCTGATATTGG + Intergenic
1170179194 20:13510086-13510108 TTAATAAATAAAGATTATATTGG + Intronic
1170254447 20:14324687-14324709 TTCAAAAATCAGGATGGTATAGG + Exonic
1170261927 20:14418938-14418960 TTCTATTTTAAAGATGAAATAGG - Intronic
1170864930 20:20145642-20145664 TTTAAATATAAAGATACAATAGG + Intronic
1170907969 20:20533235-20533257 TTAAAAAATAAAGGTGGGATGGG + Intronic
1170912493 20:20587465-20587487 TTCAGGAAAAAAAATGAAATTGG + Intronic
1170944453 20:20878524-20878546 TTAAAAAATAAATATGAGCTGGG + Intergenic
1171213938 20:23338238-23338260 TTAGAAAATAAAGATATAATTGG + Intergenic
1172278907 20:33696813-33696835 TTAAAAAATAAAGAAGACAGAGG - Intergenic
1172392649 20:34576242-34576264 TTTAAAAATAAAAATAAAATGGG + Intronic
1172417720 20:34784778-34784800 TCTAAAAATAAAAATAAAATAGG + Intronic
1172476653 20:35243437-35243459 TGAAAAAATAAAGATGAATAAGG - Intronic
1172672712 20:36645364-36645386 CTCAAAAAAAAAAATGAATTTGG + Intronic
1172694568 20:36813354-36813376 TTAAAAAAGCAAGATGAAACCGG + Intronic
1172926747 20:38544170-38544192 TTTAACAATTAAAATGAAATGGG - Intronic
1172984191 20:38969559-38969581 TTTAAAAATAAAGCAAAAATTGG - Intronic
1172998168 20:39086084-39086106 TAAATAAATAAAGATGAAAAAGG - Intergenic
1173137427 20:40451570-40451592 TTCAAAAAAAAAAAAAAAATTGG + Intergenic
1173289331 20:41700708-41700730 CTCAAAAAAAAAGAAAAAATTGG - Intergenic
1173412327 20:42823497-42823519 TTCTAAAAAAAGGAAGAAATGGG - Intronic
1173461944 20:43249864-43249886 TCCAAAAATGAAGAGGAAATGGG + Intergenic
1173654059 20:44686942-44686964 TTCAAAAAAGAAAAAGAAATAGG - Intergenic
1174010551 20:47446282-47446304 TACAAAAATAAAAATAAAATGGG + Intergenic
1174473913 20:50782479-50782501 CTCAAAAATAAAAATAAAATAGG - Intergenic
1174744600 20:53048900-53048922 TTTTAAAATAAAAATAAAATAGG + Intronic
1174997577 20:55587697-55587719 TTTAAAAAGAAAAGTGAAATTGG + Intergenic
1175099303 20:56567143-56567165 TCCAAAATTAAAGATTAAAAAGG - Intergenic
1175334528 20:58186432-58186454 TACAAAAATAAAAATAAAAGAGG + Intergenic
1175797579 20:61782008-61782030 TTCAAAAATGAAGGTGAAGCCGG + Intronic
1175866222 20:62178554-62178576 TTCAAAAACAAATCTGAATTTGG - Intronic
1176261560 20:64184327-64184349 ATCAAAAAAAAAAATGAAGTTGG - Intronic
1176276698 20:64276198-64276220 TTCATTAATAAATGTGAAATTGG + Exonic
1176584808 21:8571547-8571569 TTGAACAATAAATATGATATAGG - Intergenic
1176589232 21:8626152-8626174 TTAATAAATGAAGTTGAAATAGG + Intergenic
1177421580 21:20865429-20865451 TACACAAATGAAGATAAAATTGG - Intergenic
1177771142 21:25517769-25517791 ATAAAAAATAAATATGAAACAGG - Intergenic
1177827360 21:26098759-26098781 TTCAAAAAGAAATAAGAATTTGG - Intronic
1177928654 21:27250984-27251006 TTGAAAAATAAAAATGTAACAGG + Intergenic
1177984037 21:27951049-27951071 TTCTATAATAAAGAAGAATTTGG + Intergenic
1177985095 21:27964461-27964483 TGCAACAATATAGATGAAACCGG - Intergenic
1178053626 21:28774748-28774770 TTCAAAAATAGATTTGAAATAGG - Intergenic
1178161533 21:29922303-29922325 TTTAAAAATAAAGATGTTAATGG - Intronic
1178268176 21:31164651-31164673 TACACAAATGAAGATGTAATAGG + Intronic
1178301987 21:31460623-31460645 CTCAAAAACAAAAATGAAAAAGG + Intronic
1178465904 21:32847479-32847501 CTCAAAAAAAAAGATAAAAAAGG - Intergenic
1178539892 21:33440580-33440602 CTCAAAAATAATAATAAAATAGG + Intronic
1178609414 21:34067905-34067927 TAGAAAAATAATCATGAAATTGG + Intergenic
1178942638 21:36919828-36919850 TTCCAATATAAAGATGAAAATGG + Intronic
1179139466 21:38711749-38711771 TTTAAAAGTAAAGATCAAAAGGG + Intergenic
1179310201 21:40188687-40188709 TGCAAAAAGAAAAATGAGATGGG - Intronic
1179406446 21:41130266-41130288 TTCAAAAATAGATATGCAAAAGG + Intergenic
1179768230 21:43591161-43591183 GTTAAAAATTATGATGAAATTGG + Intronic
1180267619 22:10548449-10548471 TTGAACAATAAATATGATATAGG - Intergenic
1180272060 22:10603149-10603171 TTAATAAATGAAGTTGAAATAGG + Intergenic
1180557097 22:16586854-16586876 TTAAAAAATAAAAATTAACTGGG - Intergenic
1180671818 22:17559516-17559538 CTCAAAAATAAAAATAAAAAAGG + Intergenic
1180763507 22:18227454-18227476 TTCAAAAGTGAGGAAGAAATTGG - Intergenic
1180772137 22:18397089-18397111 TTCAAAAGTGAGGAAGAAATTGG + Intergenic
1180803516 22:18646706-18646728 TTCAAAAGTGAGGAAGAAATTGG + Intergenic
1180807249 22:18722741-18722763 TTCAAAAGTGAGGAAGAAATTGG - Intergenic
1180893978 22:19314381-19314403 TGCAACAACATAGATGAAATTGG + Intergenic
1181218202 22:21348558-21348580 TTCAAAAGTGAGGAAGAAATTGG - Intergenic
1181353054 22:22274214-22274236 TTCTAAAATAATTTTGAAATAGG - Intergenic
1182207211 22:28640725-28640747 TTCAAAACTGAGAATGAAATAGG + Intronic
1182631474 22:31689326-31689348 TTAAAAAATAAAGAAAAAACTGG + Intronic
1183571132 22:38654345-38654367 CTCAAAAAAAAAGAAAAAATGGG + Intronic
1183763182 22:39844237-39844259 TTTAAAATTAAATTTGAAATAGG + Intronic
1183923794 22:41190913-41190935 TTTAAAAATTAAGCTGAAACAGG + Intergenic
1184358748 22:44000474-44000496 TTTAGAAATACAGATGAAATAGG + Intronic
1184440208 22:44506785-44506807 TTAAAAAAGAAAAATAAAATGGG + Intergenic
1184941511 22:47769481-47769503 ATTAAAAATAAAAATAAAATAGG - Intergenic
1184958186 22:47906776-47906798 GTCAAAAAGAAAAAAGAAATGGG + Intergenic
1203233976 22_KI270731v1_random:138079-138101 TTCAAAAGTGAGGAAGAAATTGG + Intergenic
1203325644 22_KI270738v1_random:13202-13224 TTGAACAATAAATATGATATTGG + Intergenic
949192271 3:1264538-1264560 TTTAAAAATACAGATGAAGCTGG - Intronic
949221194 3:1636026-1636048 TTCCAAATTAAACATGAAACAGG - Intergenic
949338426 3:3002738-3002760 TTAACAAATAAATTTGAAATTGG - Intronic
949387376 3:3518072-3518094 TTTAAAAATCAAGGGGAAATGGG + Intergenic
949470507 3:4390991-4391013 TTCAAAAATGAAGGTGAAGGAGG - Intronic
949513845 3:4789481-4789503 TAGAAAAATGAGGATGAAATGGG - Intronic
949780592 3:7682518-7682540 TACAAAAATAAAGCTGTTATTGG - Intronic
949963866 3:9338463-9338485 GTCAAAATTATAGATGAATTTGG + Intronic
950002244 3:9666025-9666047 CTTAAAAATTAAGTTGAAATGGG - Intronic
950019666 3:9778368-9778390 GGCAAAAAGAAAGATGAAGTAGG - Intronic
950647509 3:14386158-14386180 TTCAACAATAAAGATCTATTTGG + Intergenic
950674665 3:14547497-14547519 TTCAAAAATTAAAAATAAATAGG + Intergenic
950816949 3:15714730-15714752 TATAAAAATAAAGATGCAAGAGG - Intronic
950986915 3:17382226-17382248 TGCAAAACTAAAGATTAAAAAGG + Intronic
951068244 3:18293852-18293874 TTCAAAATTAAAGATATAGTTGG + Intronic
951165373 3:19479341-19479363 CTCAAAACTCAGGATGAAATTGG + Intronic
951335290 3:21413854-21413876 CTCAAAACTAAAGTTCAAATTGG + Intergenic
951669764 3:25167627-25167649 TACAATAATCAAGATAAAATTGG - Intergenic
951831842 3:26938345-26938367 TTCAAAATAAAATATGAAAAAGG + Intergenic
952067157 3:29584450-29584472 CTCAGAAATGGAGATGAAATTGG - Intronic
952108375 3:30094325-30094347 TTTAAAAATAAAAATTAAAAAGG + Intergenic
952392470 3:32891982-32892004 TAAAAAAATAAAGATGAGGTAGG - Exonic
952769615 3:36986407-36986429 ATCAAAAAGAAAGATAAAAATGG + Intergenic
953334753 3:42084934-42084956 TGAAAAAATAAATATGAAAATGG - Intronic
953617569 3:44505143-44505165 CTCAAAAATAAAAATGAAAATGG + Intronic
953725969 3:45399188-45399210 TTCAACAAAAATGTTGAAATGGG - Intronic
953997262 3:47529587-47529609 TTTCAAAATGAAGGTGAAATAGG + Intergenic
954032374 3:47828730-47828752 CTCAAAAAAAAAGATGAAGATGG + Intronic
954592503 3:51795031-51795053 TTCATAAATAAAGATTTATTTGG + Intergenic
954762361 3:52885357-52885379 TACAAAAATTAAGTGGAAATAGG - Intronic
955289122 3:57674370-57674392 CTCAAAAAAAAAAAAGAAATTGG + Intronic
955703789 3:61707787-61707809 CTCAAAAATAATAATAAAATAGG - Intronic
955760779 3:62279704-62279726 TTTAAAAATAAAAATGTACTTGG + Intronic
955851101 3:63220786-63220808 TTAAAACATAAAGCTTAAATGGG - Intergenic
956076043 3:65507080-65507102 TGAAAAAATAAAGAAGAATTGGG + Intronic
956274491 3:67483480-67483502 TTGAAATATAAAAATGAAAGGGG - Intronic
956322244 3:68009541-68009563 TTCAACAATAAAGCTGAAATGGG - Intronic
956366429 3:68508226-68508248 TTAAAAAAAAAAGATCATATGGG - Intronic
956425830 3:69133704-69133726 TTAAAAAATATACATAAAATAGG - Intergenic
956426641 3:69142827-69142849 TTAAAAAAAAAAGATGATGTTGG - Intergenic
956511924 3:70002558-70002580 TTCAAAAATAACTATAAAACTGG - Intergenic
956593134 3:70937178-70937200 TTTAAAAATAAAGTTGAGAAAGG - Intergenic
956813066 3:72883560-72883582 TTCAAAAAAAAAAAAGAAACTGG + Intergenic
957118924 3:76063507-76063529 TACAAAAAAAAAAATAAAATTGG - Intronic
957206848 3:77209953-77209975 TTCAAAAAGAAAGATGTTTTGGG - Intronic
957248439 3:77741419-77741441 TTCAATGATAAAGTTGAAGTTGG - Intergenic
957314450 3:78559492-78559514 TTAAAAAATAAAAAGGAAACAGG - Intergenic
957423288 3:80001138-80001160 TTGAAAAATAAAAATAAAAATGG - Intergenic
957523750 3:81353749-81353771 TTCAAAAATAAACTTCAAAGTGG + Intergenic
957602839 3:82360113-82360135 TTAAAAAATAAAGAAAAAAAAGG - Intergenic
957781738 3:84827125-84827147 CTCACAAATAAAGAGGAAAATGG + Intergenic
957801352 3:85087045-85087067 ATAAAACATAAAGATAAAATTGG + Intronic
958127290 3:89373250-89373272 TTTAAAAGTAAAGATTAAATGGG - Intronic
958493342 3:94807675-94807697 ATAAAAAAGAATGATGAAATAGG + Intergenic
958544790 3:95530944-95530966 ATCAAAAACAAAAATGAAAACGG - Intergenic
958639267 3:96783899-96783921 TACAAAAATATAGTTAAAATGGG - Intergenic
958666494 3:97145573-97145595 TAGTAAAATAAACATGAAATAGG - Intronic
958669370 3:97182949-97182971 ATAAAAAACAAAGAAGAAATTGG - Intronic
959182554 3:103000090-103000112 TTCAAAAACAATAGTGAAATGGG - Intergenic
959501835 3:107115639-107115661 ATCCAAAATAAAGATAAAAATGG + Intergenic
959547762 3:107617046-107617068 TACAAAAATTAACTTGAAATGGG - Intronic
959613024 3:108316098-108316120 ATGAAAAAAAAAGATGAAAGAGG + Intronic
959772439 3:110115763-110115785 TTTAAAATTAAAAATAAAATAGG + Intergenic
959778005 3:110192441-110192463 TGAAAAAATAAACATGAAACAGG - Intergenic
959850293 3:111077926-111077948 TTAAAAAGTGAAGAAGAAATAGG + Intronic
959952827 3:112199950-112199972 TTCAGGAATCCAGATGAAATGGG - Intronic
960049960 3:113229574-113229596 CACAGAAATAAAGATGAAAGAGG - Intronic
960474076 3:118102514-118102536 TGCAATAATACAGATGGAATTGG - Intergenic
960559806 3:119071770-119071792 TTGAAAAAGAAAAATGAAGTGGG - Intronic
960588081 3:119339454-119339476 TTGAAAAAGAAAGATAAAGTGGG + Intronic
960690236 3:120339397-120339419 TCCAAAAAAAATGATAAAATTGG - Intronic
960786629 3:121379829-121379851 TTAAAAAATAAAAATTAAAAGGG - Intronic
961331557 3:126145160-126145182 TTCAAAAGGAAAGAAGAAAAGGG + Intronic
961880145 3:130056105-130056127 ATCAAAATTAAAGCTGACATTGG - Intergenic
962015528 3:131435875-131435897 TTCAAAATCAGAGATGAAAAAGG + Intergenic
962053578 3:131844761-131844783 TTAAAAATTAAAAATGGAATGGG - Intronic
962083894 3:132170307-132170329 AGCAAAAATAATGATGTAATGGG + Intronic
962117306 3:132524752-132524774 TCCAAAAAGAAAGGTGATATAGG - Intronic
962130944 3:132675157-132675179 TTTAAAAATAACGTTGAAATAGG - Intronic
962222802 3:133577980-133578002 TGAAAAAATAGAGATGAAAGAGG - Intronic
962326561 3:134439060-134439082 TTTAAAAATAAAAATAAAATTGG + Intergenic
962522604 3:136211132-136211154 TTCAAAACTACAGAGGAACTGGG + Intergenic
962768020 3:138584061-138584083 TTCAAAATCAGAGATGAAAAAGG + Intronic
962863860 3:139430314-139430336 TTAATAAATGTAGATGAAATGGG - Intergenic
963171783 3:142258193-142258215 CTCAAAAATAAATAATAAATAGG + Intergenic
963332787 3:143934056-143934078 GACAAAAATAAAGCTGAAACTGG + Intergenic
963376216 3:144468738-144468760 TTCAAAAACACAGAGGAATTGGG + Intergenic
963570915 3:146994231-146994253 TTAGAAAATCAAGAGGAAATGGG - Intergenic
963647477 3:147933973-147933995 TTCAAAAATAAAAATAAGAAAGG - Intergenic
963838513 3:150080867-150080889 TTGAAAAAACAAGATGAAATGGG + Intergenic
964503209 3:157370866-157370888 ATCACTAATAAACATGAAATTGG - Intronic
964513006 3:157474429-157474451 TTTAAAAATAAGAATAAAATAGG - Intronic
964516645 3:157517073-157517095 TACAAAAATAAAAATAAAAAAGG - Intronic
964583442 3:158267062-158267084 TTCAAAACTGAAGGTGAAATAGG - Intronic
964871243 3:161315934-161315956 TTCAAAAATAGACCTGAAGTTGG - Intergenic
965037401 3:163458499-163458521 TTTAAAAATTAAGTGGAAATAGG - Intergenic
965141137 3:164836161-164836183 TTGAAAAATAAAGAAGAAATCGG + Intergenic
965276791 3:166693739-166693761 TTAAGAAATAAAGATCAAACTGG - Intergenic
965311846 3:167138005-167138027 GGCAAAAACATAGATGAAATTGG + Intergenic
965513178 3:169591961-169591983 CTAGAAAATGAAGATGAAATGGG - Intronic
965529181 3:169754134-169754156 CTCAAAAAAAAAAAGGAAATTGG - Intergenic
965537970 3:169843834-169843856 TTCAACAACCTAGATGAAATGGG + Intronic
965944249 3:174220544-174220566 TTCAAAAATAATAATGAATTGGG + Intronic
965970570 3:174550223-174550245 TTCCAAAATAAAAATAAAAAAGG + Intronic
965978408 3:174655034-174655056 GTTAAAAATAAACATAAAATAGG - Intronic
966144456 3:176793959-176793981 TTGTGAAGTAAAGATGAAATGGG - Intergenic
966428802 3:179809687-179809709 CTCAAAAAAAAATCTGAAATTGG - Intronic
966483561 3:180441477-180441499 TTAAAAAAAAAAAAAGAAATTGG + Intergenic
966822791 3:183938297-183938319 CTCAAAAAAAAAAATGAAAATGG - Intronic
967040263 3:185685534-185685556 TTCCAAAACCAAGATGAAAATGG - Intronic
967502422 3:190214288-190214310 TTCAAAAATTAAAATAAAAAAGG + Intergenic
967529697 3:190534265-190534287 TTAAAAAAAAAAAATGAAGTGGG - Intronic
967538572 3:190637331-190637353 TATAAAAATTAAAATGAAATAGG - Intronic
967737251 3:192965812-192965834 TTTAAAAATCAAGATTAATTAGG + Intergenic
967792392 3:193563145-193563167 TTCCCAAAAAAATATGAAATGGG + Intronic
967801296 3:193663778-193663800 TAAAAAAATAAAAATAAAATTGG + Intronic
967807005 3:193723472-193723494 TTAAAAAATGAAGATGAAAGAGG + Intergenic
969066318 4:4484544-4484566 TTCAAAAAATGAGATGAAAATGG + Intronic
969417763 4:7072144-7072166 GTCCAAAATAAAGATAAAATGGG - Intergenic
969553410 4:7888496-7888518 TTCAAAAACATGGATGAAATGGG + Intronic
969685219 4:8668471-8668493 TTAAAAGATAAAGATCAGATGGG + Intergenic
969922437 4:10552916-10552938 ATTAATAATAAACATGAAATTGG - Intronic
970042847 4:11816082-11816104 TTGAAAAATAAAACAGAAATAGG + Intergenic
970057507 4:11991892-11991914 ATCACAAATAAAGATGACATTGG + Intergenic
970155479 4:13137392-13137414 TGCAAAAAGAAAGATAAGATAGG + Intergenic
970211974 4:13719354-13719376 TGCAAAAAGAGAGATGACATTGG - Intergenic
970287048 4:14529620-14529642 TTTAAAAATAAAAATGAATAGGG + Intergenic
970345270 4:15147096-15147118 TTCAGAATGAAAGATGAATTAGG + Intergenic
970394357 4:15651039-15651061 TTCAAAAATAGATAAGAAAACGG + Intronic
970651331 4:18181580-18181602 TATAAAAATAAAGATAAAAGAGG - Intergenic
970913012 4:21300266-21300288 TTCAACTATAAAAATGAAAGTGG - Intronic
970973042 4:22007275-22007297 GAAAAAAATAAAGATGAACTAGG - Intergenic
970992281 4:22226152-22226174 TTTAAAAAAAAAAAAGAAATAGG + Intergenic
971109076 4:23562208-23562230 TTCAGCAATACAGATGAAACTGG - Intergenic
971307185 4:25493823-25493845 TTCTATAAAAAAGATGAAATGGG + Intergenic
971321698 4:25611091-25611113 TTCAAAAATAAAACTGAGACTGG - Intergenic
971434283 4:26603695-26603717 TTCAAAAATAAAGAGAAAAGAGG - Intronic
971557590 4:28034525-28034547 TGCAACAACATAGATGAAATGGG + Intergenic
971571796 4:28221982-28222004 TTCAAAAAAAAAGAACAAATTGG + Intergenic
971728561 4:30346187-30346209 TTGAAAATTAAAGGTGAAGTTGG - Intergenic
971802573 4:31311142-31311164 TTAAAAAAAAAAGAAAAAATCGG + Intergenic
972052576 4:34757457-34757479 TTCCAAAATAAAAAAGAACTTGG - Intergenic
972103872 4:35458011-35458033 TTGGAAAATATAGAAGAAATTGG - Intergenic
972124996 4:35753473-35753495 TGCAACAACATAGATGAAATTGG - Intergenic
972393170 4:38632295-38632317 TTAAAAAACAAAGATAACATAGG - Intergenic
972613471 4:40676303-40676325 TTTAGAAATAAAGAAAAAATGGG - Intergenic
973043767 4:45509131-45509153 TTCAAAAAAATAAATAAAATGGG - Intergenic
973698863 4:53517251-53517273 TTCAAAAAAAAAGATCAAGGTGG - Intronic
973705619 4:53577181-53577203 TTGAAAAACAAACATGAAAATGG + Intronic
973863151 4:55085685-55085707 TTGAAAAATAAAATGGAAATTGG - Intronic
973875988 4:55218923-55218945 TTTAAAAATAAATTTGACATAGG + Intergenic
974034079 4:56802148-56802170 TTTAAAAATAAAAATAAAAAAGG + Intergenic
974194667 4:58557409-58557431 TTTAAAAATGAATATTAAATAGG - Intergenic
974241837 4:59259258-59259280 ATGAAAAATAAAAATGAATTTGG - Intergenic
974348287 4:60710949-60710971 TTAAAAAATAAAGACTAAATTGG - Intergenic
974404269 4:61445473-61445495 TGCAAAGAAAAAGATGTAATAGG + Intronic
975315171 4:72943949-72943971 TTCCAAAATACATATTAAATAGG + Intergenic
975368901 4:73561040-73561062 TTTAAAAATCAAGCTTAAATAGG + Intergenic
975371093 4:73589062-73589084 TTCAAAAGTAAAGAGGATAAGGG - Intronic
975462524 4:74671121-74671143 GGTAAAAATAAAGAAGAAATGGG + Intergenic
975700816 4:77064243-77064265 CTCAAAAAAAAAAAAGAAATAGG + Intronic
975776790 4:77796246-77796268 TTGAAAAAGAAAAATAAAATTGG + Intronic
976013486 4:80520901-80520923 ATAAAAAATAGAGATCAAATGGG + Intronic
976242896 4:82976974-82976996 TTAAAAAATAAAGTTACAATCGG + Intronic
976327924 4:83793972-83793994 TTCCAAAATAATGATGCATTAGG - Intergenic
976525361 4:86081684-86081706 TTTAAAAATAAATATGACAATGG + Intronic
976879039 4:89895683-89895705 TTTCAAATTCAAGATGAAATTGG + Intronic
976917020 4:90388608-90388630 TTTAAAAATAAACATCAAATGGG - Intronic
976930180 4:90557437-90557459 AACAAAAATAAAGATGAATGAGG - Intronic
977050077 4:92118816-92118838 TACAAAAATAAAAATGATAAAGG - Intergenic
977300947 4:95266942-95266964 TTTAATAATAAAGATGAGAGGGG - Intronic
977355825 4:95944808-95944830 TTGAAAAATAAAGATAAACATGG + Intergenic
977391999 4:96423048-96423070 TCCAGAAATAAAGAGGGAATAGG - Intergenic
977540119 4:98307334-98307356 TTCAAAAATAAATTTATAATAGG - Intronic
977710220 4:100116056-100116078 TTCAAAAGGAAATATAAAATGGG - Intergenic
977892713 4:102330409-102330431 CTTGAAAATAAAGAAGAAATAGG + Intronic
978008851 4:103653491-103653513 TTTAAAAAAAAAGCTGAAACTGG + Intronic
978067928 4:104428895-104428917 TTCAAATATAAAGATTTTATTGG + Intergenic
978105732 4:104899907-104899929 TTTAAACATGAAGATGAACTGGG - Intergenic
978218101 4:106232414-106232436 TTCAAAAATAGGGTTGGAATGGG + Intronic
978485664 4:109251184-109251206 TAACAAAATAAAGAGGAAATAGG + Intronic
978510723 4:109514822-109514844 TACAAAAATAAAGATGAGCCAGG - Intronic
978555931 4:109980333-109980355 TTCAAGAAAAGAGGTGAAATTGG - Intronic
978661659 4:111134439-111134461 TTGAAAAATCTAGAAGAAATAGG - Intergenic
979112228 4:116774399-116774421 TACAAACATAAATATGTAATTGG - Intergenic
979303927 4:119120452-119120474 TTAAAAAATCAAGATGAAGATGG + Intergenic
979433025 4:120655278-120655300 CTCAAAAGTAAAGATAAATTAGG + Intergenic
979559021 4:122081377-122081399 ATCAGAAAAAAAGAAGAAATAGG + Intergenic
979893112 4:126125344-126125366 TTTAAAAATAAAAATAAGATTGG - Intergenic
979997843 4:127454071-127454093 TATAAAAATAAAGATGGAACAGG + Intergenic
980019161 4:127687970-127687992 TTAAAAATTAAAGAGGCAATTGG + Intronic
980133657 4:128840356-128840378 TTTAAAAATTAACATGAAGTAGG - Intronic
980440469 4:132837614-132837636 TTCAAATACAATAATGAAATGGG - Intergenic
980451924 4:132984621-132984643 TTTAAAAAAAAAAATGAATTTGG + Intergenic
980454150 4:133017319-133017341 TTAAAAAATGAAAATTAAATTGG - Intergenic
980668659 4:135973622-135973644 TACAAAAACATAGATGCAATGGG - Intergenic
980680961 4:136159810-136159832 TGCTAAAATAAAGATGCAAAAGG - Intergenic
980728151 4:136791668-136791690 GACAAATATAAAGATGATATTGG + Intergenic
980731429 4:136829333-136829355 TTCAAAAAGAAAAATATAATGGG + Intergenic
980831727 4:138137448-138137470 TACAACAATACAGATGAAATTGG + Intergenic
980840421 4:138253461-138253483 CTCAAAAATAAATAGAAAATTGG + Intergenic
981186462 4:141809480-141809502 TTAAAAAAAAAAGATGGACTTGG - Intergenic
981455702 4:144951255-144951277 CTTAAAAATAAAGCTAAAATAGG - Intergenic
981472364 4:145151293-145151315 TTAAAAAATGAAAATGAAATTGG - Intronic
981623367 4:146729427-146729449 TTAAAAGATAAAAATGAACTCGG - Intronic
981659867 4:147154143-147154165 TTCACCATTAAAGATGAGATTGG + Intergenic
981711259 4:147710760-147710782 TTAAAAAAAAAAGATAAATTAGG - Intergenic
981711359 4:147711695-147711717 GTAAAAAATAAAAATAAAATTGG - Intergenic
981951089 4:150408496-150408518 TTCAAAAATATAGAGGAAGAAGG + Intronic
982289596 4:153766412-153766434 TTTACAAATAAAGATGAATAAGG + Intergenic
982508889 4:156255030-156255052 TAGAGAAAGAAAGATGAAATGGG + Intergenic
982555029 4:156850604-156850626 TTCAAGTATAAATATGAAACAGG - Intronic
982657935 4:158171950-158171972 TTAAAAAATAAAAATGGTATAGG - Intronic
982718342 4:158832409-158832431 ATCAAAAATAAAGAACAAAAGGG + Intronic
982918618 4:161246713-161246735 TTCAAAAATAAAAATGGAAGAGG + Intergenic
982931916 4:161419338-161419360 TGCAAAAATACATATGTAATTGG - Intronic
983092627 4:163522900-163522922 TTCCAAAATGAAAATCAAATTGG + Intergenic
983204109 4:164894824-164894846 TTTGAACATAAAAATGAAATGGG - Intronic
983235390 4:165173387-165173409 TTTAAAAATAAAGAATAAAAGGG - Intronic
983289430 4:165783419-165783441 TTTAAAATTAAAGATAAAATGGG - Intergenic
983374565 4:166909011-166909033 TTTAAAAAGAAAGATTAAATAGG + Intronic
983407812 4:167352563-167352585 TACAAATATAAAAATGCAATCGG + Intergenic
983451346 4:167914839-167914861 TTCATATAGAAAAATGAAATGGG - Intergenic
983702876 4:170620274-170620296 TTAAAAAATATAAATGAAATTGG - Intergenic
983797107 4:171877738-171877760 TTCTATAATAAAGAAGAAAGAGG - Intronic
984112261 4:175631362-175631384 TTTAAAAATAAACAAGCAATTGG - Intergenic
984129879 4:175861276-175861298 TACAAAAATAAGGATAAAAAGGG + Intronic
984149219 4:176106062-176106084 TTCAATAACCTAGATGAAATGGG + Intronic
984524846 4:180846503-180846525 TTCAACAATATAGATGAACCTGG + Intergenic
984709109 4:182870055-182870077 TTCTAAGAAAAAGAGGAAATAGG - Intergenic
984980595 4:185277022-185277044 TTGAAAAATAAAAATAAAAAAGG - Intronic
985291137 4:188389302-188389324 TGCAAAAATAAAGATGACCAGGG - Intergenic
985427450 4:189844675-189844697 TCCAAAAATACAAATAAAATTGG + Intergenic
985925895 5:3018458-3018480 TTTAAAAATATAAATCAAATTGG - Intergenic
986299145 5:6464761-6464783 TTCAAAAATAGAGATTCATTTGG + Intronic
986346463 5:6839934-6839956 TTCAAAACTGAAGATGATAAAGG - Intergenic
986416448 5:7533465-7533487 TTAAAAAATCAAGATAAAAATGG - Intronic
986994748 5:13594124-13594146 TTCAAAATTAAAGAAGCAATGGG - Intergenic
987141837 5:14954298-14954320 TGCTAAAATGAAGTTGAAATTGG - Intergenic
987444414 5:18000264-18000286 ATCAATAATAAAAATGAAACAGG - Intergenic
987457175 5:18162316-18162338 TGCAAAGACATAGATGAAATCGG - Intergenic
987508590 5:18806068-18806090 TGAAAAATTAAAGATAAAATGGG - Intergenic
987577175 5:19745009-19745031 GAGAAAAATAAAGAGGAAATGGG - Intronic
987850691 5:23350118-23350140 TTGAAACAAAGAGATGAAATTGG - Intergenic
988038040 5:25853071-25853093 TTAAAAAATCAAACTGAAATGGG + Intergenic
988112557 5:26841409-26841431 TTCAAGAAAAAAGAAGAAGTAGG - Intergenic
988118613 5:26929685-26929707 TTCAAAAACACAGATGGAACTGG + Intronic
988207493 5:28158857-28158879 TTAAAATATAAAGATGTCATTGG - Intergenic
988390346 5:30619720-30619742 TTCAAAAATGAAGGAGAAAGTGG - Intergenic
988447916 5:31309521-31309543 TTTAAAAATCCAGCTGAAATGGG + Intronic
988622155 5:32833975-32833997 TTCAAAAACATAGTTGCAATTGG + Intergenic
988820230 5:34876494-34876516 TTCAATAACCTAGATGAAATAGG + Intronic
989241348 5:39205890-39205912 TTTTAAAATAAGGATTAAATGGG + Intronic
989513773 5:42318736-42318758 TTCAAAAATAAACAATAAAATGG + Intergenic
990020875 5:51126149-51126171 TGCAAAAAAAAAGTTAAAATTGG + Intergenic
990122535 5:52472640-52472662 TCCAAAAATACAAATGAAACTGG - Intergenic
990193157 5:53284971-53284993 TTCAAAAATGAAAATAAAATAGG - Intergenic
990255987 5:53969792-53969814 TTCAATAATAAAAATGTAAGTGG + Intronic
990536238 5:56725630-56725652 TTTAAAAAAAAAGAAAAAATGGG + Intergenic
990565521 5:57023968-57023990 TTGAAAAAGAAAAATAAAATTGG + Intergenic
990729401 5:58791946-58791968 TTCTAAAATGGAGATGATATTGG + Intronic
990754088 5:59048807-59048829 TACAGAAATTAAGAAGAAATTGG - Intronic
990796757 5:59551706-59551728 TTCAAAAATCAAGCTAACATGGG - Intronic
990895096 5:60690866-60690888 ATCAAAAATAAAAGAGAAATAGG - Intronic
991165647 5:63563439-63563461 CTCAAAAATGAAAATGAAAGCGG - Intergenic
991171955 5:63637966-63637988 TTGGAAAGTAAATATGAAATAGG - Intergenic
991172458 5:63644653-63644675 CTCAAAAATAAAGGTAGAATGGG + Intergenic
991186106 5:63809780-63809802 ATTAAAAAAAAAGATGTAATTGG - Intergenic
991439105 5:66627723-66627745 TAAAAAAAAAAAGCTGAAATAGG + Intronic
991602094 5:68363101-68363123 TTCAATAAAACAGATGAAATAGG + Intergenic
991707515 5:69372144-69372166 CTCAAAAATATAGAGGAAAGGGG + Intronic
992278446 5:75146589-75146611 TTAACAAATAAAAAAGAAATGGG - Exonic
992395641 5:76367083-76367105 TTCATAAATATAATTGAAATGGG - Intergenic
992428466 5:76683581-76683603 TTGAAAAATGAAAATGACATGGG - Intronic
992814550 5:80423522-80423544 ATAAAAAATAAAAATTAAATTGG - Intronic
992907616 5:81361843-81361865 TTAAAAAACAAAAAAGAAATTGG - Intronic
993078731 5:83269578-83269600 TTCAAAAAATAACCTGAAATTGG + Intronic
993124980 5:83822813-83822835 TTCAAAAAGAGAGAAGGAATAGG - Intergenic
993132638 5:83918784-83918806 TTAAAAAATAAGGTTAAAATAGG + Intergenic
993146830 5:84104390-84104412 TTCAAAAAAAAAAAGAAAATTGG + Intronic
993165008 5:84341704-84341726 TTTAAAAAAATAGTTGAAATGGG - Intronic
993179284 5:84530035-84530057 TTAAATAATATAAATGAAATTGG - Intergenic
993180368 5:84544956-84544978 TACAAAGAGAAAGATGAGATTGG - Intergenic
993199293 5:84792107-84792129 TTCACACACAAAGATGAAACTGG - Intergenic
993243825 5:85426407-85426429 TTCAAAATTAAAATTAAAATCGG + Intergenic
993326994 5:86552819-86552841 TACAAAAATCAACTTGAAATGGG + Intergenic
993403261 5:87478841-87478863 TTCAACAACCAAGATGAAGTAGG - Intergenic
993465360 5:88239037-88239059 TTTAAAAAGAAACACGAAATTGG - Intronic
993732177 5:91435551-91435573 TTCATAAATAGAGATGAAGGAGG + Intergenic
994025543 5:95077789-95077811 TTTAAAAACTAACATGAAATAGG + Intronic
994058033 5:95441608-95441630 TTAAAAAAAAAAGGTTAAATAGG + Intronic
994250429 5:97529882-97529904 TGCAAAGACAAAGATGAAGTGGG + Intergenic
994365001 5:98904460-98904482 CTCAAAGATAATGATGGAATAGG - Intronic
994542966 5:101122826-101122848 TGCAAAAATGTAGATGAAATCGG - Intergenic
994545204 5:101157226-101157248 TTAAAAAGTAATGATGAAAATGG - Intergenic
994735381 5:103547590-103547612 TTAAAAAATAAGGATGGCATAGG - Intergenic
994859761 5:105174686-105174708 TTCATAAAAAAAGATGACTTAGG + Intergenic
994861092 5:105195157-105195179 TTTGAAAATATATATGAAATTGG - Intergenic
994929852 5:106167438-106167460 TTTATAAATGAAGATGCAATAGG + Intergenic
994997037 5:107077099-107077121 TTCAAAACAAGAGAGGAAATTGG - Intergenic
995121308 5:108538478-108538500 TTCCAAAAATATGATGAAATCGG + Intergenic
995166955 5:109054738-109054760 TACAAAAATTAACTTGAAATGGG - Intronic
995205921 5:109481564-109481586 TTAAAAAATAATGATTAAAATGG - Intergenic
995481750 5:112600292-112600314 TTCACAAATATACATGAAAATGG - Intergenic
995500657 5:112802953-112802975 TTTAAAAATAAAATTAAAATGGG + Intronic
996170648 5:120286496-120286518 TTGATAAATAAGGATAAAATGGG + Intergenic
996518153 5:124396475-124396497 TACAAAAAGAAAAATAAAATTGG - Intergenic
996828993 5:127719194-127719216 TTCAACAATATGGATGAAATTGG - Intergenic
996861380 5:128071033-128071055 TTCAAAAATAAAGTACAAAGAGG + Intergenic
996942888 5:129030538-129030560 ATCAAAAAGAGAGATGAAATAGG - Intronic
997342881 5:133159551-133159573 TTCAAACATAATGATGTGATTGG - Intergenic
997861739 5:137423939-137423961 TACAAAAATAAACTTGAAATGGG - Intronic
998276783 5:140762239-140762261 CTCAAAAAAAAAGTTGAAAAAGG - Intergenic
998358971 5:141567669-141567691 TTCACTAATAAAGATGCAACTGG + Intronic
998730119 5:145065368-145065390 TTGAAAAATAAATTTGAATTGGG + Intergenic
998830195 5:146149238-146149260 GTCAAAAATAAAAATGTAAAGGG + Intronic
998866005 5:146503362-146503384 TTTTAAAATACAGATTAAATCGG + Exonic
998930360 5:147174552-147174574 ATCAAAAAAAAAGAAGAAACAGG + Intergenic
999363373 5:151005075-151005097 TTTAAAAAGAAAGATTCAATGGG + Intergenic
999469840 5:151844168-151844190 TTAAAAAAAAAAAATGAAGTTGG + Intronic
999505547 5:152191674-152191696 TACAAAAATTAACTTGAAATAGG - Intergenic
999582244 5:153051771-153051793 GTAGAAAATAAAGAGGAAATAGG - Intergenic
999598224 5:153229508-153229530 TTTAAAAATCTAGATGAAATGGG - Intergenic
999811138 5:155128370-155128392 TTGAAAAATAAAGAAGAAAAAGG - Intergenic
999846062 5:155481499-155481521 TTCCAAAACAAAGCTGAAAGAGG - Intergenic
999847730 5:155503944-155503966 TACAGAAATGAAGATAAAATTGG + Intergenic
999864098 5:155682107-155682129 TTTAGAAATAAAGGAGAAATAGG - Intergenic
999918838 5:156295310-156295332 TTCTAAAATAAAAATAAAAGTGG - Intronic
1000422020 5:161048747-161048769 TTAAAAAATAAAGATCATCTGGG + Intergenic
1000476622 5:161716074-161716096 TTAAAAAATAAAGTTCATATTGG + Intergenic
1000774188 5:165396569-165396591 TTTAAAAATAAAGCTCTAATGGG - Intergenic
1000873973 5:166612721-166612743 TTAAAAAAGAAAAATGAAATTGG + Intergenic
1000920963 5:167136594-167136616 TATAGAAATAAAGAAGAAATAGG - Intergenic
1000952584 5:167502267-167502289 TTAAACAAAAAAGAAGAAATAGG - Intronic
1000988594 5:167888233-167888255 TTCAATAATAGAGAAGACATAGG - Intronic
1001134035 5:169087744-169087766 ATCAAAAATTAAAAGGAAATAGG + Intronic
1001138564 5:169123547-169123569 TGCAAAAATAAAGTTGAACGAGG + Intronic
1001819053 5:174695493-174695515 TTCAAAATTAAGGAAGTAATTGG - Intergenic
1001832290 5:174799000-174799022 CTCTAAAATGGAGATGAAATGGG + Intergenic
1001935823 5:175704164-175704186 TTCAAAAATAAGTATCAAAAAGG + Intergenic
1002776375 6:331291-331313 TGAAAAAGTAAAGATAAAATGGG - Intronic
1002956403 6:1869709-1869731 TTAAAAAATAAAAAAGAAATCGG + Intronic
1002988887 6:2219194-2219216 TTAAAATATAAAGATGCAAATGG - Intronic
1003411430 6:5866352-5866374 TAAAAAAATAGACATGAAATAGG - Intergenic
1003708462 6:8561745-8561767 TTTGTAGATAAAGATGAAATAGG + Intergenic
1003923173 6:10852838-10852860 TTCAAAAAAAAAAAAGAAAGTGG - Intronic
1003933103 6:10946558-10946580 TTCAAGAATAAAGGTTGAATGGG - Intronic
1003969351 6:11283221-11283243 TTCAAGAATAAAAATAAAATAGG - Intronic
1004009735 6:11671403-11671425 TTCAAAAACAAAAATGAAGAAGG + Intergenic
1004445242 6:15691951-15691973 TTTTAAAATAAAAATGAAACTGG - Intergenic
1004702605 6:18093121-18093143 TTCAAAAAAAAAAAAGAATTAGG - Intergenic
1004793729 6:19057805-19057827 TGCAAAAACATGGATGAAATTGG + Intergenic
1004891500 6:20105397-20105419 CTCAGATATAAAGATGAATTAGG + Intronic
1005146473 6:22696596-22696618 TTCAAAGCTAAAGCTGAAACTGG - Intergenic
1005228683 6:23673314-23673336 TTCAAATATGAAGAAGAAATAGG - Intergenic
1005651499 6:27889382-27889404 TTAAAAAATAAAAATAAAAAAGG - Intergenic
1006863600 6:37190494-37190516 TTTAAAAATAAAAATAAACTGGG + Intergenic
1006953548 6:37845770-37845792 TTGGGAAATAATGATGAAATGGG + Intronic
1007035982 6:38674253-38674275 CTCAAAAATAATAATAAAATGGG - Intergenic
1007135214 6:39514117-39514139 TTCAAAAGTAGGTATGAAATTGG - Intronic
1007529395 6:42527745-42527767 TTTTAAAAGAAAGATAAAATGGG - Intergenic
1007852142 6:44813347-44813369 TACAAAAATAAAAATTAACTGGG - Intronic
1008521793 6:52368483-52368505 TTTAAAAAAAAAGAAGAAAAGGG + Intronic
1008533610 6:52488683-52488705 TTCAAAAAAATAAATGAAAGAGG - Intronic
1008850716 6:56017633-56017655 TACAAAAATACAGATCAAAATGG - Intergenic
1009052704 6:58296875-58296897 TGCAAAAATTCAGATGAAAGGGG + Intergenic
1009238402 6:61153708-61153730 TGCAAAAATTCAGATGAAACGGG - Intergenic
1009321965 6:62302759-62302781 TTCAAAAGAGAAGATGAAGTAGG - Intergenic
1009337894 6:62516279-62516301 TTTAAAAAAAAAGTTGAAGTAGG - Intergenic
1009505183 6:64468800-64468822 TACAGCAACAAAGATGAAATTGG - Intronic
1009784672 6:68319485-68319507 TTCAACAAGAAAAATAAAATGGG - Intergenic
1009865134 6:69387914-69387936 ATGAAAAATAAAAAGGAAATTGG + Intronic
1009926231 6:70124553-70124575 TTCAAAAAAAAAAAAAAAATGGG + Intronic
1009936279 6:70238143-70238165 TTAAAAAATCTAGATGACATTGG + Intronic
1010018933 6:71137874-71137896 TTATAAAATAAACATAAAATAGG + Intergenic
1010603157 6:77855571-77855593 TTAGAAAGTAAAGATTAAATTGG + Intronic
1010976215 6:82316849-82316871 TTCAAAAATATAGAGAAAAAGGG + Intergenic
1011387820 6:86816226-86816248 TACAAAAATCAAATTGAAATGGG + Intergenic
1011446322 6:87445168-87445190 TTTAAAAATAAAAAAGAAAGGGG - Intronic
1011911047 6:92439174-92439196 TTAAAAACCAAACATGAAATTGG + Intergenic
1011917410 6:92524990-92525012 TTGAAAAACAAAAATAAAATTGG + Intergenic
1012013583 6:93825300-93825322 TTCAAAAAGAGTAATGAAATTGG - Intergenic
1012050350 6:94334439-94334461 TACAAAAAAAAAATTGAAATAGG + Intergenic
1012071128 6:94618131-94618153 TTCAAAAATAAAAAGAAAAAAGG + Intergenic
1012123486 6:95396853-95396875 TTAAAAACTCAACATGAAATGGG + Intergenic
1012127465 6:95449068-95449090 TTCAAGAATAAAAATAAAATTGG - Intergenic
1012225414 6:96698092-96698114 TTCAACAACATAGATGAAACTGG + Intergenic
1012253819 6:97009301-97009323 ATTTAAAATATAGATGAAATTGG - Intronic
1012368660 6:98475688-98475710 TGCAAAAATAAAAATAAAATTGG + Intergenic
1012660190 6:101879463-101879485 TTCAAATAAAACTATGAAATTGG - Intronic
1013191645 6:107808711-107808733 TGCAAAAATAGAAATGAAAAAGG - Intronic
1013333997 6:109136582-109136604 TTGCAAAATAAAGATAAAAATGG - Intronic
1013341946 6:109223650-109223672 TTCAAAGATAAGGTTTAAATTGG + Intergenic
1013595790 6:111659646-111659668 TAAAAAAAAAAAGATGAAACAGG - Intergenic
1013917449 6:115358386-115358408 GTCAAAAATAAAAATAAAAAAGG - Intergenic
1014089337 6:117385595-117385617 TTTAAAAAAAAAAAAGAAATTGG + Intronic
1014130974 6:117832666-117832688 ATCAAAAACAATGCTGAAATGGG + Intergenic
1014292365 6:119573290-119573312 TTGAAAAATAGAGAGGAAAAAGG + Intergenic
1014371363 6:120613006-120613028 TTCAAAAAACAACATGAAATAGG - Intergenic
1014439177 6:121453942-121453964 ATAAAAAATAAAAATAAAATTGG - Intergenic
1014630149 6:123779018-123779040 TTTAAAAATAAAAATGAATAAGG - Intergenic
1015003777 6:128253141-128253163 CTCAGAAATAAAATTGAAATAGG + Intronic
1016110293 6:140214937-140214959 TTCTAAAAGAAAAATGAAGTTGG - Intergenic
1016161511 6:140886484-140886506 TTAAAAAAGAAAAATAAAATTGG - Intergenic
1016346546 6:143119927-143119949 CTCAAAAATAAAAATAAAAAAGG - Intronic
1016633331 6:146257740-146257762 ATCAAAAAAAAAGATGAAAGGGG - Intronic
1016673679 6:146738428-146738450 AAAAAAAAAAAAGATGAAATGGG - Intronic
1016991676 6:149934184-149934206 TGCAAAAATAGGTATGAAATAGG - Intergenic
1017529717 6:155276915-155276937 TTCTAAAATGAAAAAGAAATGGG - Intronic
1017581861 6:155873452-155873474 TTCAAAAAGAAAGTTGAGAACGG + Intergenic
1017600552 6:156076148-156076170 TTGAAAAAAAAAGATGAGCTTGG + Intergenic
1017689347 6:156947665-156947687 TTTAAAAATGAAGAAAAAATAGG - Intronic
1018364209 6:163101248-163101270 TTTAAAAAACAAGATGTAATTGG + Intronic
1018383711 6:163284111-163284133 CTCAAAAAAAAAAATTAAATAGG + Intronic
1018749244 6:166788851-166788873 ATAAAAAATAAAAATAAAATAGG + Intronic
1019032936 6:169028747-169028769 TTCAACAATGAAGATGTCATAGG - Intergenic
1020164113 7:5794925-5794947 TTTAAAATAAAACATGAAATAGG + Intergenic
1020176584 7:5887090-5887112 ATAAATAATAAAGAGGAAATGGG - Intergenic
1020444142 7:8250707-8250729 TTCACAAGTAAATGTGAAATGGG + Intronic
1020551341 7:9609161-9609183 TGCAAAATTAATAATGAAATTGG + Intergenic
1020722507 7:11765585-11765607 TTCAAAAATAAAATTTAAGTTGG - Intronic
1021171895 7:17407243-17407265 TACAAAATGAAAGAAGAAATAGG + Intergenic
1021206885 7:17792138-17792160 GTCAAAAATATATTTGAAATGGG + Exonic
1021312905 7:19115424-19115446 TTTAAAACTAAAGATTAAGTTGG - Intronic
1021564891 7:22007331-22007353 TTCATAAACAATGTTGAAATGGG - Intergenic
1021572001 7:22075419-22075441 GTTAAAAATTAAGATAAAATTGG - Intergenic
1021690841 7:23229505-23229527 TTTAAAAATAAAGATAAAGAAGG + Intergenic
1021698740 7:23297816-23297838 TTAAAAAATAAAAATAAAAAAGG + Intergenic
1021974010 7:25994059-25994081 TGCAAAAATAAAGGTGAATTTGG + Intergenic
1022247929 7:28578924-28578946 TTCAAAATTTGAGATCAAATTGG - Intronic
1022452069 7:30524764-30524786 TTGAAAAGTAAACATTAAATAGG + Intronic
1022633416 7:32107565-32107587 TTCAAAAGTGAAGAACAAATAGG + Intronic
1022681458 7:32550656-32550678 TACAAATAAAAAGATGAAAATGG + Intronic
1022886595 7:34653155-34653177 TACAAAAATATATGTGAAATTGG + Intergenic
1023409450 7:39874864-39874886 CACAAAAATAAAAAGGAAATTGG - Intergenic
1023445529 7:40227593-40227615 TTATAAAATAAAGTTGACATTGG - Intronic
1023581266 7:41686146-41686168 ATCTTAAATAAATATGAAATTGG + Exonic
1023672072 7:42587604-42587626 TTTAGAAATAAAGATGTAATAGG - Intergenic
1023679178 7:42666654-42666676 TTAAAAAATAATAATAAAATTGG + Intergenic
1024363987 7:48500473-48500495 TTCAAAAAGGAAGATGGACTTGG - Intronic
1024807177 7:53156499-53156521 TTGAACAATAAATATGATATAGG + Intergenic
1024917746 7:54522746-54522768 TGCAAAAAAAAAAATAAAATAGG - Intergenic
1025043480 7:55669158-55669180 CACAAAAATAAAAAGGAAATTGG + Intergenic
1025136401 7:56417671-56417693 CACAAAAATAAAAAGGAAATTGG + Intergenic
1025319511 7:58079690-58079712 TTGAACAATAAATATGATATTGG - Intergenic
1025477926 7:60950161-60950183 TTGAACAATAAATATGATATTGG - Intergenic
1025483343 7:61014427-61014449 TTGAACAATAAATATGATATAGG - Intergenic
1025489158 7:61090357-61090379 TTGAACAATAAATATGATATAGG + Intergenic
1025554205 7:62283781-62283803 TTGAACAATAAATATGATATTGG + Intergenic
1025560576 7:62369493-62369515 TTGAACAATAAATATGATATTGG - Intergenic
1025857624 7:65296847-65296869 TTCAAAAAAAAAAAAAAAATGGG - Intergenic
1026312954 7:69203819-69203841 CTAAAAAATAAAGAATAAATAGG - Intergenic
1026391074 7:69902461-69902483 TTGAGAACTACAGATGAAATAGG + Intronic
1026633414 7:72059024-72059046 TTTAAAAATATAAATGAAATTGG - Intronic
1026698577 7:72618897-72618919 TTAAAAAAAATGGATGAAATTGG + Intronic
1026708047 7:72712326-72712348 CTCAAAAAAAAAGATGCTATTGG - Intronic
1027232055 7:76278495-76278517 TAAAAAAATAAAAATGAAAGAGG + Intronic
1027431425 7:78116917-78116939 TTTGAAAACTAAGATGAAATAGG + Intronic
1027914726 7:84301748-84301770 TTCACAAATAAACCTGAATTTGG + Intronic
1028127929 7:87135959-87135981 TTCAAAGCTAAAGATATAATCGG - Intergenic
1028206156 7:88019974-88019996 TTCCATAATATAGATGAAAATGG + Intronic
1028206791 7:88026760-88026782 TTGAATAATAGTGATGAAATTGG + Intronic
1028261447 7:88671536-88671558 AACAAAAATAAAGATGATAATGG - Intergenic
1028359764 7:89953605-89953627 TTAAAAAAAAAAAATCAAATGGG + Intergenic
1028533259 7:91862524-91862546 TAAAAAAATAAAAAGGAAATAGG - Intronic
1028615504 7:92762318-92762340 TTCAAGAATAGGGAAGAAATAGG - Intronic
1028663140 7:93306762-93306784 ATCAAAAATAAAAATCATATTGG - Intronic
1028763846 7:94527664-94527686 TTCAAAAATAAGTAAGAATTAGG + Intronic
1029058253 7:97769447-97769469 TTCAAAGAAAAAAATTAAATGGG + Intergenic
1029082246 7:97983930-97983952 ATAAATAATAAAGAGGAAATGGG + Intergenic
1029209474 7:98894527-98894549 TAAAAGCATAAAGATGAAATAGG + Intronic
1029876849 7:103763518-103763540 GATAAAAATAAAGATGATATAGG + Intronic
1029975763 7:104831669-104831691 TTGAAAAATAAAAATGCAGTGGG + Intronic
1029987423 7:104934794-104934816 TCCAAAAGTAAAGATGAGAATGG - Intergenic
1030049753 7:105527546-105527568 ACCAAGAATAAAGATGACATAGG - Intergenic
1030906715 7:115193613-115193635 TTGAAATACAAAGAAGAAATTGG - Intergenic
1030921739 7:115397908-115397930 TCCAAATCTAAAGATGAAAAAGG - Intergenic
1030969052 7:116031379-116031401 CTTAAAAATACAAATGAAATTGG - Intronic
1030981445 7:116189343-116189365 TTCCAAAATAAAGAAAAACTAGG + Intergenic
1031609435 7:123807729-123807751 TTCAAAAATACATAAAAAATAGG - Intergenic
1031730543 7:125294607-125294629 TACAACAATAAAGATGAACCTGG - Intergenic
1031873926 7:127116650-127116672 TTGAAAAATGAAGAAGAAAAAGG + Intronic
1032829145 7:135605007-135605029 TTCCAACATAAAGATACAATGGG - Intronic
1033340739 7:140490394-140490416 TCTAAAAATAAAAATAAAATAGG - Intergenic
1033348571 7:140543890-140543912 CTCAAAAATAAAAATAAAATAGG - Intronic
1033612431 7:142977207-142977229 TTGAAAAATAAGAATGAAGTAGG + Intergenic
1033718640 7:144032195-144032217 TTCAGAAATAAAGTTGAAATTGG - Intergenic
1033773383 7:144579201-144579223 TTCAGAAAACAATATGAAATTGG + Intronic
1033817227 7:145087738-145087760 TTTGAAAATTTAGATGAAATGGG - Intergenic
1033889932 7:145999558-145999580 TTCAAAAATAAATTTTAAAATGG - Intergenic
1033915365 7:146317839-146317861 TTCCAATAAAAAGATGAAATTGG + Intronic
1034620218 7:152451120-152451142 TTAAAAAATAAAAATTAACTGGG + Intergenic
1034681803 7:152934528-152934550 TTGAAAAAAAAAGATCACATTGG + Intergenic
1034691333 7:153016463-153016485 TGCAGAAATTAAGATGAAATTGG - Intergenic
1035143816 7:156792326-156792348 TTGAAAAATTAAGATGTAAACGG + Intronic
1035558056 8:581027-581049 TTAAATAATAAAAATGAAACTGG - Intergenic
1035816844 8:2550454-2550476 GTCAGAAATAAGGCTGAAATTGG + Intergenic
1035834837 8:2738920-2738942 TGCAAAAAAAAAAATGAAACCGG - Intergenic
1036227698 8:6973750-6973772 CTCTAAAATATTGATGAAATAGG + Intergenic
1036230151 8:6992905-6992927 CTCTAAAATATTGATGAAATAGG + Intergenic
1036232603 8:7012008-7012030 CTCTAAAATATTGATGAAATAGG + Intronic
1036459979 8:8943539-8943561 TTCAAAAATAAAGTTTCAACTGG - Intergenic
1037070782 8:14646038-14646060 TTCAAAAATAAAAATAAAAAAGG - Intronic
1037092390 8:14938260-14938282 TTCAAAAATAAATATGCAGTTGG + Intronic
1037280243 8:17233107-17233129 TTAAAAAAGAAAGATGAGAGTGG + Intronic
1037379032 8:18264317-18264339 TTGAAAAATGAAGAGTAAATTGG + Intergenic
1037416125 8:18651738-18651760 TTCAAGAAAACAGATGGAATAGG + Intronic
1037506585 8:19536709-19536731 TTCAAAAAGAAAAATGAAGTGGG + Intronic
1037601548 8:20400459-20400481 TTTAAAAATAAAAATGACATGGG + Intergenic
1037725354 8:21478713-21478735 TGAGAAAATAAAAATGAAATCGG - Intergenic
1037730039 8:21516563-21516585 TTAAAATAAAAAGATGAAAGGGG - Intergenic
1037837981 8:22225492-22225514 TCAAAAAATAAAAATGAAAAAGG + Intronic
1037847563 8:22297279-22297301 TACAAAAATAAAAATAAAATAGG - Intronic
1038109891 8:24484231-24484253 TTCAATAATAAAGAGAAAAATGG + Intronic
1038359353 8:26861983-26862005 TTCAAAAATATAAATGAGACTGG + Intronic
1038812563 8:30864575-30864597 TTCAGAAATGAAGAAGAAATAGG + Intronic
1038829859 8:31044653-31044675 TTCAAAATAGAAAATGAAATTGG - Intronic
1038875512 8:31544065-31544087 TTCAAAAACAAAAAAAAAATTGG - Intergenic
1038881743 8:31621550-31621572 TTTAAAAATAAGAATGGAATTGG + Intergenic
1039316985 8:36384488-36384510 TTCAAGAAAGAAGATGACATAGG + Intergenic
1039702579 8:39977790-39977812 ATTAAAAATAAAAATAAAATTGG - Intronic
1039727586 8:40236215-40236237 TAAAAAAATAAAAATGGAATTGG - Intergenic
1039844962 8:41319546-41319568 TTAAAAAATAAAGAACAAATGGG - Intergenic
1040012157 8:42670831-42670853 TTCTAAATTAAAGAAGAAAAAGG - Intergenic
1040625340 8:49142130-49142152 TACTAAAATAGAGATGAAAATGG + Intergenic
1040851344 8:51903806-51903828 TTCTGAAATGAAGATGAAAAAGG + Intergenic
1040930776 8:52733166-52733188 TAGAAGAATACAGATGAAATGGG + Intronic
1041159413 8:55023464-55023486 TTGAAAAATAAGAATGAAGTAGG + Intergenic
1041583193 8:59486120-59486142 TTAAAAAATATATATGAAAAAGG - Intergenic
1041789135 8:61672194-61672216 TTTAAAAATAAAAAAGCAATTGG - Intronic
1041878376 8:62716598-62716620 TTTAAAAATAAAGAACAAAAAGG - Intronic
1042038153 8:64560645-64560667 TTAAAAAAAAAAAAAGAAATTGG + Intergenic
1042137878 8:65649482-65649504 AATAAAAATAAAGATAAAATGGG - Intronic
1042177104 8:66047730-66047752 TTCAAAGATTAATATAAAATAGG + Intronic
1042183196 8:66112552-66112574 TTTAAAATTAAACATAAAATAGG + Intergenic
1042460890 8:69067083-69067105 ATGAAGAATAAAGTTGAAATCGG - Intergenic
1042581841 8:70288278-70288300 TTTAAAAATATGGAGGAAATAGG + Intronic
1042589679 8:70385427-70385449 TTCAAAAAATAAAATAAAATTGG - Intronic
1042654430 8:71080464-71080486 TTTAAAAATCAAGAAAAAATAGG - Intergenic
1043246467 8:78009163-78009185 TTCTGAAACAAAGATGACATAGG - Intergenic
1043302138 8:78746834-78746856 TCCAAAAATAAAGGTGGAAAAGG + Intronic
1043417331 8:80064442-80064464 TGCAAAAATAAAGTTGCAAAAGG + Intronic
1043599875 8:81923995-81924017 TTCAGATATTCAGATGAAATGGG - Intergenic
1043621645 8:82200179-82200201 TTAAAAAATAAATTTAAAATTGG - Intergenic
1043732645 8:83702962-83702984 AACAAAAATAAAGACAAAATTGG + Intergenic
1043867059 8:85387668-85387690 CTCAAAAATAAAAATAAAAAAGG - Intronic
1043886317 8:85604681-85604703 AGCCAAAATATAGATGAAATTGG + Intergenic
1043953637 8:86337757-86337779 TTCACAAGTACAGGTGAAATAGG + Intergenic
1044027120 8:87186673-87186695 TTCAAAAAGAAATTTAAAATAGG - Intronic
1044027121 8:87186730-87186752 TTCAATAATAAATTTAAAATGGG - Intronic
1044060789 8:87632201-87632223 TTCAACAGTAAAGTTAAAATGGG - Intergenic
1044236834 8:89840829-89840851 TTCAAAACAAAAGCTGAAACTGG - Intergenic
1044296933 8:90538858-90538880 TCCAAATATAAAAATGTAATGGG - Intergenic
1044311874 8:90702874-90702896 TTCAGAAACTAAAATGAAATAGG - Intronic
1044386198 8:91591482-91591504 TTAAAAAATAGAGGTGAAACTGG + Intergenic
1044651502 8:94500401-94500423 TTCAAAAATAAAAATGTTAATGG + Intronic
1044940611 8:97338705-97338727 TTCAAAAATAAAAACAAAATAGG + Intergenic
1044973375 8:97641500-97641522 TTTAAAAATAAAAATATAATTGG - Intergenic
1045104636 8:98879959-98879981 GTCAAAAATAAATATAAAATAGG + Intronic
1045122689 8:99055339-99055361 TTGAAAAAGAAATATAAAATAGG - Intronic
1045504025 8:102765969-102765991 TTCAAAAAAAAAAAAAAAATGGG - Intergenic
1045625286 8:104039616-104039638 CTCACAAGTAAAAATGAAATTGG - Intronic
1045795780 8:106042103-106042125 TTAAAAAAGAAAGATAAAGTTGG - Intergenic
1045852616 8:106720917-106720939 TTGTAATATAAAGATGAATTTGG + Intronic
1045873088 8:106947834-106947856 GTAAGAAATAAAGATGAAGTGGG + Intergenic
1045942986 8:107760236-107760258 TTTAAAAATAAGGATATAATTGG + Intergenic
1046095515 8:109554978-109555000 TTAAAAAAAAAAAAAGAAATAGG - Intronic
1046154620 8:110271447-110271469 TTCAAATAAAATGATAAAATAGG + Intergenic
1046186618 8:110729813-110729835 TTCAAAAGTAGAGATGAATTAGG + Intergenic
1046612489 8:116441411-116441433 ATCCAAAATAAAGAAGAATTTGG + Intergenic
1046654534 8:116878600-116878622 TTCAAATATAAACATAAAACAGG - Intergenic
1046675398 8:117102693-117102715 TGCAAAGATGAAGAAGAAATTGG - Intronic
1046782195 8:118227522-118227544 GTTAAAAAAAAAGATGACATGGG + Intronic
1047147886 8:122226061-122226083 ATAAAAAATATAAATGAAATGGG + Intergenic
1047376173 8:124299314-124299336 TTCAAAAATGAAGGTGAAATGGG - Intergenic
1047378437 8:124329388-124329410 CTGAAAAATAATGATGAAACTGG + Intronic
1047930085 8:129719199-129719221 TTGAAAAAGAAAGATGCATTTGG + Intergenic
1047965385 8:130042532-130042554 TTTAAAAATAAAAATGAAACTGG - Intergenic
1048061809 8:130926874-130926896 TTCAATAATATAGATGAACGTGG - Intronic
1048063086 8:130940721-130940743 TTCAAAAAGAAAAATAAAGTAGG + Intronic
1048570105 8:135645499-135645521 TTAAAACATAAAGATGAAGGTGG - Intronic
1048660585 8:136596032-136596054 ATGAAAAATAAAAATAAAATAGG + Intergenic
1049082804 8:140456691-140456713 TTAACAAATAAAGATGTCATAGG + Intronic
1049128330 8:140812305-140812327 TTCATAAATAAAGGAGATATAGG + Intronic
1049137439 8:140916100-140916122 TTCAAAAATAGAAATGAAAAGGG + Intronic
1049186069 8:141254514-141254536 TTCAGTAATAATGATGAAACTGG - Intronic
1050200607 9:3141530-3141552 TTAAAAATCAAAGATAAAATTGG + Intergenic
1050207200 9:3209535-3209557 TTGAAAAAGAAGGATAAAATTGG - Intergenic
1050245287 9:3682935-3682957 TTCAAAAAGAGAGAAAAAATAGG - Intergenic
1050290591 9:4150200-4150222 AACAAAAATAAAGCTGAAAGGGG + Intronic
1050435421 9:5604721-5604743 TTCAAAAACTTAGGTGAAATGGG + Intergenic
1050609638 9:7338063-7338085 TTCAGAAAGAAAGATGAAATAGG - Intergenic
1050628803 9:7537166-7537188 TTAAAGAATAAAGAAAAAATAGG - Intergenic
1050692720 9:8246327-8246349 TTGAAAAATTAACCTGAAATTGG + Intergenic
1050950602 9:11586786-11586808 TTCAAAAATTAAGGCAAAATAGG + Intergenic
1051147838 9:14047851-14047873 ATGAAAAATAAACATAAAATAGG - Intergenic
1051566188 9:18501207-18501229 TTCAAAAGTAAAAGAGAAATGGG + Intronic
1051622085 9:19061186-19061208 TTTAAAAATACAAATAAAATTGG + Intronic
1051657119 9:19393806-19393828 TTCAAAAGTGAAGGAGAAATAGG + Intergenic
1051820765 9:21164267-21164289 TACTAAACTCAAGATGAAATAGG - Intergenic
1052079916 9:24192152-24192174 TGCAAACACAAATATGAAATGGG + Intergenic
1052261439 9:26521037-26521059 TTGTAAAATAAAGATGTAACTGG - Intergenic
1052306742 9:27018944-27018966 TTGAAAAATAAAGGTGATCTAGG - Intronic
1052375142 9:27710658-27710680 TTGGAAAATCAAGAAGAAATGGG - Intergenic
1052401730 9:28009355-28009377 TAAAAAAAAAAAGATAAAATGGG + Intronic
1052415271 9:28169974-28169996 TTTAAAAATATAGATGAAATAGG - Intronic
1052474788 9:28944908-28944930 TTCTACAAAACAGATGAAATAGG + Intergenic
1052566386 9:30158535-30158557 TTAAACAAATAAGATGAAATAGG + Intergenic
1052613301 9:30803857-30803879 TTAAAAAATTAATAAGAAATAGG + Intergenic
1052686829 9:31767205-31767227 TTCAAAAATAAATATGGTAGGGG - Intergenic
1052715137 9:32106720-32106742 TCCATAAAGAAAAATGAAATAGG + Intergenic
1052825709 9:33172755-33172777 CTAAAAAATAAAGATAAAAGAGG + Intergenic
1053091198 9:35278721-35278743 TTCAAAAAATAAAATAAAATGGG - Intronic
1053121738 9:35552374-35552396 TTAAAAAATAAAAATAAAAAAGG + Intronic
1053405831 9:37874698-37874720 ATCAAAAATTAAGATGGATTAGG - Intronic
1054442726 9:65282211-65282233 TTGAACAATAAATATGATATAGG + Exonic
1054487550 9:65739290-65739312 TTGAACAATAAATATGATATAGG - Intergenic
1054703746 9:68441043-68441065 TTCAACAACTTAGATGAAATGGG + Intronic
1054961305 9:70973039-70973061 TTCCAATATAAAGATGAAACAGG + Intronic
1055220375 9:73922251-73922273 ATGAATAATAAAGATGAATTAGG - Intergenic
1055247907 9:74269064-74269086 TTAAAAAATAAAAAAAAAATAGG + Intergenic
1055689529 9:78814601-78814623 TTCAAACATAAAGATGTTACTGG + Intergenic
1055710150 9:79051824-79051846 CTCAAAAAAAAAAATGTAATAGG + Intergenic
1055935466 9:81600460-81600482 TTTAAAAAGAAAAATGAGATGGG - Intronic
1056047678 9:82735917-82735939 TTCATAAATAAAGTTGTATTAGG - Intergenic
1056211907 9:84372594-84372616 AGCAAAAATAAAGATAAATTAGG - Intergenic
1056784943 9:89584789-89584811 TACAAAAATTAAGATTAAAGAGG + Intergenic
1057255812 9:93546084-93546106 AACAAAAATAAAGAAGGAATTGG - Intronic
1057477684 9:95417131-95417153 GTCAAAAAAAAAAATGTAATAGG + Intergenic
1057494397 9:95548920-95548942 TTCAAAAAAAAAGATTATAATGG + Intergenic
1058059612 9:100481339-100481361 TCCACAAATAAATATGTAATGGG - Intronic
1058311414 9:103508123-103508145 TTGAAAAATAAAAATAAAAGAGG + Intergenic
1058333717 9:103798963-103798985 TTAAAAAATAAAGATCAATCTGG + Intergenic
1058731419 9:107853802-107853824 CTCAAAAATAAAAATAAAAAAGG - Intergenic
1058768272 9:108204876-108204898 TGCAAAAATATAGATGGAACTGG + Intergenic
1058857733 9:109081389-109081411 CTAAAAAATACAGATAAAATTGG + Intronic
1059078629 9:111223042-111223064 ATCAGAAACAAAGAGGAAATAGG + Intergenic
1059187631 9:112289864-112289886 TTTACAAATAAAAATGATATGGG - Intronic
1059514430 9:114879819-114879841 TTAAAAAATAGAGAAGGAATTGG - Intergenic
1059962971 9:119585084-119585106 TTCAGAAATAAAGATTAAACTGG - Intergenic
1060362403 9:122972265-122972287 TTAAAAAATAAAAATAAAAATGG + Intronic
1060457449 9:123811756-123811778 CTCAAAAATAAAAATAAAAAAGG + Intronic
1061012298 9:127962865-127962887 TTAAAAAAGAAAAAAGAAATAGG + Intronic
1061651483 9:132054030-132054052 ATCAAAACTAAAGATAATATGGG + Intronic
1061705075 9:132446885-132446907 TTAAAAAGTAAAAATAAAATGGG - Intronic
1061831347 9:133297568-133297590 TTGAAAAAAAAAGATCAATTAGG + Intergenic
1203614714 Un_KI270749v1:49066-49088 TTGAACAATAAATATGATATAGG - Intergenic
1203619236 Un_KI270749v1:104735-104757 TTAATAAATGAAGTTGAAATAGG + Intergenic
1185719379 X:2370170-2370192 TTCAAAAAAAAAGACGAACTGGG - Intronic
1185843476 X:3415501-3415523 TTCAGAAATAAAAAAAAAATTGG + Intergenic
1186029671 X:5354264-5354286 CTCAAAAATAAATAAGAAAAAGG - Intergenic
1186320579 X:8420081-8420103 ATCACAAAGAAAGATGCAATAGG - Intergenic
1186527516 X:10262804-10262826 TTGAAAAAGAAAGATGGAAGAGG - Intergenic
1186570637 X:10711671-10711693 TTAAAGAATCAAGATGCAATAGG + Intronic
1186796792 X:13054513-13054535 TACAAAAATATAACTGAAATCGG + Intergenic
1187054826 X:15732674-15732696 TTCAAAATTAAAGACAATATTGG - Intronic
1187084767 X:16030539-16030561 TTAAAAAAGCAAGATGACATGGG + Intergenic
1187484628 X:19691116-19691138 TTTAAAAATAATAATAAAATGGG - Intronic
1187803245 X:23088475-23088497 ACCAAAAATAATGATTAAATAGG + Intergenic
1187906897 X:24075163-24075185 TTCCAAAAAAAAGAAGAAAGAGG - Intronic
1187985605 X:24807491-24807513 TTAAAAAATGAAGATGAAGTTGG + Intronic
1187987343 X:24828657-24828679 TTCAAAACCAAAGAAGAAAAGGG - Intronic
1188088445 X:25932100-25932122 TACAGAAATAAATATGACATGGG + Intergenic
1188169045 X:26899069-26899091 TTTAAGAATAAAAATGAGATTGG - Intergenic
1188374463 X:29410552-29410574 TTCAAAAATCCATATGAAGTGGG - Intronic
1188439074 X:30196739-30196761 TTCAAAAATGAAGATCAACGAGG - Intergenic
1188735853 X:33714827-33714849 TTTAAAAATATTGATGGAATTGG - Intergenic
1188940965 X:36237035-36237057 TTCAATTATAAAGTTGAATTAGG + Intronic
1188973134 X:36641540-36641562 TTAAAAAATAAAAATAAAAAGGG - Intergenic
1189548038 X:42063309-42063331 CTAAAAAATCAAGAGGAAATGGG - Intergenic
1189617917 X:42803329-42803351 TTGAAAGATATAGATAAAATAGG - Intergenic
1189635720 X:43006702-43006724 TTTGAAAATTAAGATAAAATGGG - Intergenic
1189676482 X:43465804-43465826 GACAAAAATAAAAATGAAAATGG + Intergenic
1190130722 X:47746372-47746394 TTTAGAAAAAAAGATTAAATTGG + Intergenic
1190410065 X:50128020-50128042 CTCAAAAAGAAAGATGACTTCGG + Intergenic
1190502295 X:51091592-51091614 TGCGAAAATAAAGGAGAAATGGG + Intergenic
1190580333 X:51887393-51887415 TTGAAAAAGAAAGATAAAGTGGG + Intronic
1191178643 X:57535906-57535928 TTCAAAAATCAAGTTAAAGTTGG - Intergenic
1192156735 X:68752446-68752468 TTCAGAAATAAATATTTAATAGG + Intergenic
1192306273 X:69963178-69963200 TTTAAAAATAATAATGGAATGGG + Intronic
1192627068 X:72740436-72740458 TTCAATAACTGAGATGAAATGGG - Intergenic
1192656557 X:73000410-73000432 TTTAAAAATAAAGAATAAAAAGG + Intergenic
1192665563 X:73082591-73082613 TTTAAAAATAAAGAATAAAAAGG - Intergenic
1192719697 X:73679435-73679457 TTGAAAAATAAATACAAAATGGG + Intronic
1192737921 X:73866264-73866286 TTTAGAAATAAAGATGAGGTTGG + Intergenic
1192773024 X:74213465-74213487 TTAAAAAATAGAGAGGAAAGAGG - Intergenic
1192782832 X:74311505-74311527 TTGAAAAACAAGGATAAAATGGG + Intergenic
1192788713 X:74358798-74358820 TTCAAAAAAAAAAAAAAAATTGG - Intergenic
1193081704 X:77412566-77412588 TTCTAAAATAAAAATGGAAGAGG + Intergenic
1193144252 X:78061168-78061190 TTCAAAAAAAGAGATGAAGATGG - Intergenic
1193156503 X:78179899-78179921 ATCCAAAATATAGATGAAAAAGG - Intergenic
1193180808 X:78454139-78454161 TTCAAAAAAAAAGGTGAAGAGGG + Intergenic
1193309112 X:79984811-79984833 TTCAAAAATAAAGAAAAATAAGG - Intergenic
1193528911 X:82629624-82629646 TTGAAAAATATAGAAGAAATAGG + Intergenic
1193558766 X:82991011-82991033 TTAAAAAATAGAGTTCAAATGGG + Intergenic
1193597572 X:83465836-83465858 TTCAAGAATAAAGACAAGATAGG + Intergenic
1193623763 X:83791185-83791207 TTCAAAAACATAGAAGAAATGGG + Intergenic
1194134751 X:90127156-90127178 TTCAAAAATTAAACTGAGATTGG - Intergenic
1194232641 X:91342985-91343007 TTCAAAAAGAAAAAGGAAATAGG - Intergenic
1194278053 X:91912313-91912335 TTGAATAATAATGGTGAAATTGG + Intronic
1194336124 X:92648272-92648294 TTGAAAAATAAGAATGAAATAGG + Intergenic
1194345191 X:92754721-92754743 TTAAAAAATAAATATGAACCCGG + Intergenic
1194380651 X:93187151-93187173 TTCAAAAATGTAGATGTAATGGG - Intergenic
1194504594 X:94716665-94716687 CTCAAAATTAGAGATGAAAAAGG + Intergenic
1194537776 X:95127834-95127856 TGCAACAATATGGATGAAATTGG + Intergenic
1194546661 X:95243555-95243577 TTGAAAAATCTAGAAGAAATTGG + Intergenic
1194667350 X:96689823-96689845 TTCAAGAATAGACATAAAATGGG - Intronic
1194698464 X:97084625-97084647 ATGAAAAATAAAGATCAAAGGGG - Intronic
1194709638 X:97219489-97219511 TTGAAAAGTAAAGATAAAAAAGG + Intronic
1195215853 X:102701400-102701422 TTCAGAATCAAAGCTGAAATTGG + Intergenic
1195522246 X:105844649-105844671 TTCAAAAAAGGAGAGGAAATGGG - Intronic
1195775716 X:108403535-108403557 AACAAAAATAAAGAGCAAATTGG - Intronic
1195795778 X:108645292-108645314 TTCAAAAACATAAATAAAATTGG + Intronic
1196002401 X:110800158-110800180 TTAAAAAATAAATATGTAAGTGG + Intergenic
1196309338 X:114143824-114143846 TTCAAGTATAAAAATAAAATGGG - Intergenic
1196323814 X:114377430-114377452 TGAAATAATAAAAATGAAATAGG + Intergenic
1196353541 X:114761486-114761508 TTTTAATGTAAAGATGAAATGGG - Intronic
1196751220 X:119119463-119119485 ATAAAAAATGAAAATGAAATAGG + Intronic
1197268227 X:124398480-124398502 TTCAAAAAGAAAGAAAAAAATGG - Intronic
1197282279 X:124551182-124551204 TGCTATAATAAAGATGAGATTGG + Intronic
1197382923 X:125767289-125767311 CAGAAAAAAAAAGATGAAATTGG - Intergenic
1197398977 X:125965426-125965448 TTCACAAAGAAAAATCAAATGGG - Intergenic
1197861784 X:130978930-130978952 TTAAAAAAGAAAGATCACATAGG - Intergenic
1197887044 X:131229374-131229396 TTCATAAAAAAAAATGAAAGAGG - Intergenic
1198044326 X:132885400-132885422 CTCAATAAAAAAAATGAAATCGG + Intronic
1198157803 X:133979633-133979655 TTCAAAAATCAAGGTGAAGGTGG - Intronic
1198275089 X:135092745-135092767 TGGAAAGATAAAGATGAAGTGGG + Intergenic
1198385037 X:136120749-136120771 TTGAAAAAGAAAAATGAAGTTGG - Intergenic
1198646949 X:138818817-138818839 TTTTAAAATAAAAATAAAATGGG + Intronic
1198766169 X:140081244-140081266 CTAAAAAATAAAAATAAAATGGG - Intergenic
1198890285 X:141387100-141387122 TGCAAAAATAAAAACGATATGGG + Intergenic
1199056313 X:143299189-143299211 TTCCAAAGAAAAGATAAAATTGG + Intergenic
1199135729 X:144249455-144249477 TGCAAAAATATAGATGGAATTGG + Intergenic
1199558138 X:149131619-149131641 TTAAAAAAAAAAAAAGAAATTGG - Intergenic
1199638775 X:149839698-149839720 TTCAAGAATTGAGATGGAATTGG - Intergenic
1199674704 X:150178031-150178053 TTAAAAAATAAAGAGAAAAAAGG - Intergenic
1200480535 Y:3697267-3697289 TTCAAAAATTAAACTGAGATTGG - Intergenic
1200595391 Y:5134388-5134410 TTGAATAATAATGGTGAAATTGG + Intronic
1200644558 Y:5765016-5765038 TTGAAAAATAAGAATGAAATAGG + Intergenic
1200653532 Y:5871368-5871390 TTAAAAAATAAATATGAACCCGG + Intergenic
1200736829 Y:6808249-6808271 TTAAAAAATAAAGATTATTTAGG - Intergenic
1201222561 Y:11786173-11786195 TTCAAAGATAAATATGCAAATGG + Intergenic
1201362419 Y:13167425-13167447 TCCAAAAAGAAAGATGAGTTTGG + Intergenic
1201485685 Y:14492266-14492288 TTCCACAATGAAGATGAAACAGG - Intergenic
1201596689 Y:15678288-15678310 TACAAAAATAAAGAAGGAATTGG + Intergenic
1201649800 Y:16273249-16273271 TTCATAAATAAATATGATTTTGG + Intergenic
1201785789 Y:17776849-17776871 TTTAAAAAAAAAAATGAAAATGG - Intergenic
1201815764 Y:18129139-18129161 TTTAAAAAAAAAAATGAAAATGG + Intergenic
1201949643 Y:19549926-19549948 AGCAAAAGTAAACATGAAATTGG + Intergenic
1201988432 Y:19994968-19994990 TTTAAACAAAAAGATGCAATGGG + Intergenic
1202036123 Y:20638185-20638207 TTCAAAAAGACAAATAAAATTGG - Intergenic
1202038366 Y:20658235-20658257 CTCAAAAATGAAGGTGAAGTGGG + Intergenic