ID: 1065030286

View in Genome Browser
Species Human (GRCh38)
Location 10:21579101-21579123
Sequence TTTTTGAAGGGCATTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065030282_1065030286 -8 Left 1065030282 10:21579086-21579108 CCTATTTCATCTTTATTTTTGAA 0: 1
1: 0
2: 13
3: 167
4: 1499
Right 1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065030286 Original CRISPR TTTTTGAAGGGCATTGTGGT TGG Intronic
No off target data available for this crispr