ID: 1065030302

View in Genome Browser
Species Human (GRCh38)
Location 10:21579418-21579440
Sequence AGAGAGAAAGAATATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1423
Summary {0: 1, 1: 3, 2: 14, 3: 126, 4: 1279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065030302_1065030304 -9 Left 1065030302 10:21579418-21579440 CCTGCCTCATATTCTTTCTCTCT 0: 1
1: 3
2: 14
3: 126
4: 1279
Right 1065030304 10:21579432-21579454 TTTCTCTCTTCTTCTTTTTAAGG No data
1065030302_1065030307 20 Left 1065030302 10:21579418-21579440 CCTGCCTCATATTCTTTCTCTCT 0: 1
1: 3
2: 14
3: 126
4: 1279
Right 1065030307 10:21579461-21579483 GTTATGCATGTGAGACCTTTTGG No data
1065030302_1065030305 -2 Left 1065030302 10:21579418-21579440 CCTGCCTCATATTCTTTCTCTCT 0: 1
1: 3
2: 14
3: 126
4: 1279
Right 1065030305 10:21579439-21579461 CTTCTTCTTTTTAAGGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065030302 Original CRISPR AGAGAGAAAGAATATGAGGC AGG (reversed) Intronic
900839193 1:5033925-5033947 AGAGAGAAAGAATGAGTGCCAGG + Intergenic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
901056937 1:6452791-6452813 ACAGAGAAGGAAACTGAGGCTGG - Intronic
901105064 1:6748843-6748865 AGAGAGAGAGAAAGTGAAGCAGG - Intergenic
901125638 1:6926628-6926650 AGAAAGAAAGAAGAAGAGGAGGG - Intronic
901174676 1:7290281-7290303 AGAGGGACTGAATATGATGCAGG - Intronic
901584961 1:10282294-10282316 AGATAGAAAGAAGAGAAGGCAGG - Intronic
902185316 1:14720570-14720592 ATATTGCAAGAATATGAGGCAGG - Intronic
902477438 1:16695704-16695726 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
902982363 1:20134158-20134180 AGAGAGAAAGAAACAGAGGGAGG - Intergenic
903163271 1:21504097-21504119 TGAGATAGAGAAGATGAGGCTGG + Intergenic
903225823 1:21893796-21893818 AGAGATAAAGAAAGTGGGGCGGG + Intronic
903373487 1:22851698-22851720 GGAGAGGAAGGAGATGAGGCTGG - Intronic
903793183 1:25908324-25908346 AGGGAGAAAGAAAATGTGGGGGG - Intergenic
904117542 1:28173811-28173833 AGAGAGACAGAATATGCAGGGGG - Intronic
904661223 1:32086777-32086799 AAAGAGAGAGAAACTGAGGCTGG + Intronic
904951716 1:34246677-34246699 AGAGAAAAATAAATTGAGGCAGG + Intergenic
904998538 1:34650303-34650325 AGAGAGAAAGAGAAAGAGGGAGG + Intergenic
905030085 1:34876433-34876455 AGAGTCAAAGAAAATGGGGCTGG + Intronic
905163332 1:36057034-36057056 AAAGAAAAAGAATAGTAGGCCGG - Exonic
905249971 1:36642079-36642101 TTAGAGAAAGGAGATGAGGCTGG + Intergenic
905394587 1:37658822-37658844 ATAGAGAAAGAAAATAGGGCTGG + Intergenic
905436795 1:37961783-37961805 AGAAAGAAAGAAAAAAAGGCCGG + Intronic
905595409 1:39202260-39202282 GCAGATAAAGAATATGAGGCCGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906011827 1:42534205-42534227 AAAGACAAAGAAAATGAGGGGGG + Intronic
906167217 1:43695681-43695703 TCAGAGTAAGAATTTGAGGCTGG + Intronic
906335180 1:44923780-44923802 AGAGAGAAAGAGAAGGAGGGAGG - Intronic
906433336 1:45774031-45774053 AGAAAAAAAGAAAATGTGGCTGG + Intergenic
906719652 1:47996367-47996389 AGACAGAAAAAATATGAGAAAGG + Intronic
906721777 1:48011399-48011421 AGAGAGAAAGAAAAGGAAGGGGG - Intergenic
906782654 1:48586371-48586393 GGAGAGAAAGAAAAGGAGGATGG + Intronic
906804120 1:48763519-48763541 AGAGAGAGAGACGATGAGGGTGG + Intronic
907270503 1:53288254-53288276 AGAGAGAAAGAAACTGAGGCTGG - Intronic
907430714 1:54409696-54409718 AGACAGAGAGAATATGAGTCAGG - Intronic
907539774 1:55203228-55203250 ATAGAGAAAGTTTATGAGGAAGG + Intronic
907724556 1:57007013-57007035 AGAGAGAAAAAAAAGGAGGTAGG - Intronic
907825492 1:58012875-58012897 AGAGAGAGAGACTGTGTGGCAGG + Intronic
907969007 1:59362329-59362351 GGAGAGAAGAAATAGGAGGCAGG - Intronic
908022197 1:59909424-59909446 AGAGAGAAAGTATGTCAGGATGG + Intronic
908081413 1:60582908-60582930 AAAGACAAAGATTATGAGGGTGG - Intergenic
908744537 1:67362805-67362827 AGAGAGAAGGAAAATGAGATAGG + Intronic
908902842 1:68976100-68976122 AGAGAGAAAGAAAGAGAGGAGGG - Intergenic
908927648 1:69275507-69275529 AGAGAGAAAGAAAAGGAGAGAGG + Intergenic
909057597 1:70840815-70840837 AGAGAGATAGAAGATAAGGAAGG - Intergenic
909104596 1:71392646-71392668 TGAGAGAAAGAGTAGGAGGGAGG - Intergenic
909469304 1:76008841-76008863 AGAGAAAAAGGAAATGAGGGTGG - Intergenic
909608309 1:77528727-77528749 AGGCAGAAGGAATATGAGGGAGG + Intronic
909610336 1:77545268-77545290 AGAGAGAAAGAATGAGGGGCTGG - Intronic
910272352 1:85410341-85410363 TGAGAAAAAGGAAATGAGGCCGG + Intronic
910357843 1:86379909-86379931 TGAGAGACGGAATATTAGGCTGG + Intronic
910378418 1:86598013-86598035 AGAGTGAAAGTAGATGAGGTTGG + Intergenic
910396391 1:86798509-86798531 AGGAAGGAAGACTATGAGGCAGG + Intergenic
910407623 1:86906554-86906576 AGAAAGAAAGAATACTAGCCAGG - Intronic
910440646 1:87248127-87248149 AGAGAGAGAGAGAATGAGGCGGG + Intergenic
910454383 1:87381189-87381211 AGAGACATAAAAAATGAGGCAGG - Intergenic
911087472 1:93990856-93990878 AGAAAGAAAGAAAATTAGCCAGG - Intergenic
911389907 1:97228895-97228917 TGCAAGAAAGAATTTGAGGCTGG + Intronic
911445950 1:97992139-97992161 AGAAAGAAGGAATATGATTCAGG - Intergenic
911469050 1:98293777-98293799 AGAGAGAAAGAATGAGAGAGAGG + Intergenic
911690438 1:100827087-100827109 AGAGAGAAAGAACAAGAAGACGG - Intergenic
911767859 1:101700968-101700990 GGAGAGGAAGAATATCAGGAAGG - Intergenic
911788562 1:101981873-101981895 TGAAAGAAAGAATATGAAGAAGG + Intronic
911876989 1:103179106-103179128 AGTAAGAAAGAAATTGAGGCCGG + Intergenic
911904998 1:103555877-103555899 AGAGAGAAAAAACATAATGCCGG + Intronic
911957728 1:104259504-104259526 TGAGAGAAAGACCTTGAGGCAGG - Intergenic
912319583 1:108699445-108699467 AGAGAGAAAGAAAATGAGAGAGG + Exonic
912456740 1:109803208-109803230 ACAGAGAAGGAAAATGAGTCAGG + Intergenic
913089552 1:115467129-115467151 AGAAAGAAAGAAAAGGAGGTGGG + Intergenic
913118491 1:115718229-115718251 AATGAGAAAGAACATGAGTCTGG + Intronic
913206433 1:116543467-116543489 AGAAACAATGAAAATGAGGCAGG + Intronic
913511263 1:119564729-119564751 ACAGAGAGAGAAAATGAGGGGGG + Intergenic
914197836 1:145459121-145459143 AGAAAGAAAGAAAGTGAGGGAGG + Intergenic
914357328 1:146898325-146898347 AGAAAGAAAGAAGAGGAGGAGGG + Intergenic
914395591 1:147264563-147264585 ATTGAGAAAGAATCTGAGTCAGG + Exonic
914435001 1:147652024-147652046 ATAGATAAAGAAACTGAGGCTGG - Intronic
914476939 1:148032245-148032267 AGAAAGAAAGAAAGTGAGGGAGG + Intergenic
914926696 1:151894901-151894923 AAAAAGAAAGAATATAATGCAGG - Intronic
915074527 1:153297618-153297640 AGAAAGAAAGAAGAGGAGACAGG + Intergenic
915178796 1:154040570-154040592 AGAAAGAAAGAATCTTAGGGAGG - Intronic
915397348 1:155595472-155595494 AAAGAAAAAGAAATTGAGGCCGG - Intergenic
915687108 1:157644703-157644725 AGTGAGACACAATATGAAGCAGG + Intergenic
916091292 1:161309686-161309708 AGAAAGAAAAAATATGCGGCTGG - Intronic
916349518 1:163833200-163833222 GGAGAGAAAAGAAATGAGGCTGG - Intergenic
916386414 1:164276663-164276685 AGAGAGAAAGAAGAGGAAGGAGG + Intergenic
916387930 1:164298093-164298115 AGAGAAAAAGAATAAAAGGGAGG - Intergenic
916678007 1:167080465-167080487 AGAGAGAAGCACTAGGAGGCAGG - Intronic
917181101 1:172298816-172298838 AGAGAGAAAGAAAAAAAGGAAGG + Intronic
917387267 1:174491044-174491066 AGGGAGATAGAGCATGAGGCAGG - Intronic
917643952 1:177011070-177011092 ACAGAGAGAGGATAAGAGGCTGG - Intronic
917843345 1:179000646-179000668 AGAAAGAAAGAAAAAAAGGCCGG - Intergenic
918029703 1:180793829-180793851 GGAGAGAAAGAAAATGAGGGTGG - Intronic
918300503 1:183199497-183199519 AGAGAGAAAGGAATTGAGGGAGG - Intronic
918427854 1:184428480-184428502 AGAGAGAAAGAACATGAAGAGGG + Intronic
918782004 1:188711448-188711470 AGAGAGAAAGAAAATGATATAGG + Intergenic
918808024 1:189075468-189075490 AGAGAAACAGAAAATGAGCCAGG + Intergenic
918948915 1:191109259-191109281 AGAGAGATAGAGTATGTGGAGGG + Intergenic
919135820 1:193506840-193506862 AGAGCGAAAGAATATGGGAGGGG + Intergenic
919321629 1:196048051-196048073 AGAGAGGAGAAAAATGAGGCAGG + Intergenic
919333055 1:196195473-196195495 AGAAAGAAAGAATAGAAGGAAGG + Intergenic
919363729 1:196629852-196629874 AGAGACAAAGAAAAAGAGGAGGG + Intergenic
919412653 1:197265431-197265453 AGAGAGAAAGAGGAGGAGGGAGG - Intergenic
919530988 1:198719904-198719926 AGTGATAAAGAATATGGGCCGGG - Intronic
919638256 1:200024875-200024897 AGAGAGAGAGAAGATGGGGAAGG + Intergenic
919710375 1:200721331-200721353 AGAGAGAGAGAGAAAGAGGCCGG - Intergenic
920100511 1:203514274-203514296 AGAGAGAGAGAGACTGAGGCGGG - Intergenic
920307092 1:205025922-205025944 TGAAAGAAAGACAATGAGGCTGG - Intergenic
920547876 1:206833710-206833732 AGAGAGAGAGAAAATGAGACTGG - Intronic
920592261 1:207231836-207231858 AGAAAGAAAAAACTTGAGGCTGG - Intergenic
920730206 1:208476376-208476398 AGGGAAAAAGAATATGAGCCAGG + Intergenic
920747950 1:208646716-208646738 AGAGAGAAAGAAGAAAAGGAAGG - Intergenic
920773753 1:208915260-208915282 AGAGGGAAAGAATGTCACGCAGG - Intergenic
920826665 1:209429290-209429312 AATGAAAAAGAACATGAGGCCGG - Intergenic
920837515 1:209525402-209525424 AGAGAGTAAGAAAGTGAGGCAGG + Intergenic
921079659 1:211728455-211728477 AGAGAAAAAGAACATGAGCCTGG - Intergenic
921575629 1:216831505-216831527 AGAGAGAGAGAGAAAGAGGCAGG + Intronic
921988939 1:221343064-221343086 AGATAGAAAGAATATGAAAGTGG + Intergenic
922195422 1:223355512-223355534 AGAAAGAAAGAAAATGGGCCTGG - Intronic
922268041 1:224005765-224005787 TAAGTGAAAGAATATGAGGCTGG + Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922376607 1:224974718-224974740 AGAGAGTAGGAATAAGAGGAAGG - Intronic
922441267 1:225656837-225656859 AAAGAAAAAAAATATGAGCCAGG + Intergenic
922501977 1:226103942-226103964 AAAGAGAAAAAATATGGGCCAGG - Intergenic
922519315 1:226234576-226234598 GCAGAGAAAGAAGATGAGCCCGG - Intronic
923148791 1:231216141-231216163 AGAGAGAAAGAGAAGGAGGGAGG - Exonic
923153323 1:231254388-231254410 TGAGAGTAAGAAGAGGAGGCAGG - Intronic
923292483 1:232560026-232560048 AGAGAGAGAGCAGATTAGGCAGG - Intronic
924039664 1:239971917-239971939 AGAAAGAAAGAAAAGGAGGGAGG + Intergenic
924153125 1:241149451-241149473 AGTAAAAAAGAAAATGAGGCTGG - Intronic
924762480 1:247001414-247001436 AGAAAGAAAGAAAAGGAGCCGGG + Intronic
1063304592 10:4885739-4885761 ATAAAAAAAGAATGTGAGGCCGG + Intergenic
1063331574 10:5164883-5164905 AGAGAGAAAGAAAATGCAGTAGG - Intergenic
1063650545 10:7932489-7932511 AGAGAGATTGATTATGAGTCTGG + Intronic
1063692181 10:8297228-8297250 AAAGAGAAAGAAAGTGTGGCAGG - Intergenic
1063754996 10:8997604-8997626 AGAGAGAGAGAATGGGAGGGAGG - Intergenic
1063919067 10:10913808-10913830 AGAGAGAAAGAAAGGGAGGGAGG + Intergenic
1064425354 10:15224927-15224949 AGAGAAAAACTATATGAGGTTGG - Intronic
1064589662 10:16875819-16875841 AGAGAAGAAGAATATAAAGCAGG + Intronic
1064631818 10:17322258-17322280 AGAGAGAAAGAAAAGAAGGAGGG + Intronic
1064839393 10:19573518-19573540 GAAGAGAAAGAAAATGAGGGAGG - Intronic
1064853791 10:19741581-19741603 TGAGAGAATAATTATGAGGCTGG - Intronic
1064895788 10:20234689-20234711 AGGGAGACAGAATAAGAAGCAGG - Intronic
1064974525 10:21099718-21099740 AGGGAGAAAGACTGTGAGCCAGG + Intronic
1065030302 10:21579418-21579440 AGAGAGAAAGAATATGAGGCAGG - Intronic
1065175224 10:23068916-23068938 AGAAAGAAAGAAAATTAGCCAGG + Intergenic
1065175253 10:23069200-23069222 AGGGAGACAGAATCTGTGGCTGG - Intergenic
1065184913 10:23162219-23162241 ACAAAAAAAGAAAATGAGGCTGG + Intergenic
1065214605 10:23438386-23438408 AGAAAGAAAGAAAATTAGCCGGG + Intergenic
1065449283 10:25839371-25839393 AGAGAGAAAGAAAAAGAGAAGGG + Intergenic
1065674747 10:28162836-28162858 TGAGAGAAAGAATATGGAGGGGG - Intronic
1065677158 10:28188979-28189001 AGAGAGAAAGAAAATCATGTAGG + Intronic
1065693122 10:28355411-28355433 AGAGATAAAGAATTTAAGGCTGG - Intergenic
1066008848 10:31173616-31173638 TGAGAGAAAGCTTATTAGGCAGG + Intergenic
1066043479 10:31576783-31576805 AGAAAGAAAGAAAAGGAGGGAGG + Intergenic
1066648707 10:37635750-37635772 AGAAAGGAAGAATACGGGGCAGG + Intergenic
1066725656 10:38389840-38389862 TAAGTGAAAGAATACGAGGCTGG - Intergenic
1067377825 10:45744040-45744062 AGAAAGAAAGAAAAAGAGCCGGG - Intronic
1067426902 10:46217375-46217397 AGAGGGAAAGGAGATCAGGCAGG + Intergenic
1067435183 10:46272104-46272126 AGAGAGGAAGAAACTGAGTCAGG - Intergenic
1067484248 10:46632144-46632166 AGTGAGAAAAAAAATGAGACAGG - Intergenic
1068223068 10:54067695-54067717 AGAGAGAAAGAATATTAACCTGG + Intronic
1068316881 10:55356260-55356282 AGAGGGAAAGAATAAGAGATGGG + Intronic
1068467593 10:57415089-57415111 GAAGAGAAAGAAGATGAGGAGGG + Intergenic
1068493587 10:57756056-57756078 AGACAGCAAAAATATGAGACTGG + Intergenic
1068715232 10:60180299-60180321 AGAAAGAAAGCATATGTGGCTGG + Intronic
1068739212 10:60449999-60450021 AGAGAAAAAGATAAAGAGGCTGG + Intronic
1068774300 10:60854357-60854379 AGAGACAAAGAGACTGAGGCTGG - Intergenic
1069700694 10:70422970-70422992 AGAGAGGAAGAAAGTGAGGGAGG - Exonic
1070546386 10:77456164-77456186 AGAGTCAAAGACTGTGAGGCAGG + Intronic
1070658256 10:78285950-78285972 AGAGAGACAGACAATGAGGAGGG - Intergenic
1070763510 10:79042237-79042259 AGAGAGAAGGAAAATGATACAGG + Intergenic
1071625921 10:87169761-87169783 AGTGAGAAAAAAAATGAGACAGG + Intronic
1071807122 10:89135604-89135626 TAAAAGAAAGTATATGAGGCCGG + Intergenic
1072271275 10:93779491-93779513 AGGGAGAAAGAAAAAGAGGAAGG + Intronic
1072299941 10:94050303-94050325 AGAGAGAAAGCATGTGAAGGGGG + Intronic
1072439179 10:95438728-95438750 AGAAAGGAAGAACATGGGGCTGG - Intronic
1072973532 10:100038069-100038091 AAAAAGAAAGAATATCTGGCCGG - Intergenic
1073311762 10:102547852-102547874 AGAGAGAAAGAAAGAGAGGCTGG + Intronic
1073494235 10:103876836-103876858 AGAGAAGAAGTAGATGAGGCTGG - Intergenic
1073611275 10:104946387-104946409 AGAGAGAAAGGACATGAGCCAGG - Intronic
1073782519 10:106854995-106855017 AGAGAGAAGGAAAATGATACAGG - Intronic
1073900817 10:108218380-108218402 TTAGAGGAACAATATGAGGCTGG + Intergenic
1074196947 10:111197798-111197820 AATGAGAATGAATATGAGACAGG + Intergenic
1074209687 10:111319048-111319070 AGAGAGAGAGAAAATGAAGACGG - Intergenic
1074495481 10:113976633-113976655 AGAGAGAGAGAAAATTAGCCAGG - Intergenic
1075292098 10:121239584-121239606 AGAGAGAAAGGACAGGAGGGTGG - Intergenic
1075315068 10:121446741-121446763 AGATAGAAAGAATAGTGGGCCGG + Intergenic
1075330819 10:121572768-121572790 GGAGAGAGAGAAACTGAGGCAGG + Intronic
1075473306 10:122710450-122710472 ATTGAGATGGAATATGAGGCTGG + Intergenic
1075483185 10:122799671-122799693 AGAGATAAAGGAAATGAGGGTGG - Intergenic
1075527320 10:123197641-123197663 AGAGAGAGAGTATATGTGTCAGG + Intergenic
1075664575 10:124221408-124221430 ACAGATAAAGGAAATGAGGCCGG + Intergenic
1075994716 10:126868089-126868111 AGAGTGAAGGGAGATGAGGCTGG - Intergenic
1077072367 11:681390-681412 AGAAAGAAAGAAAATTAGCCGGG - Intronic
1077168799 11:1157349-1157371 AGAGAGAGAGCACATGCGGCAGG - Intergenic
1077258414 11:1600865-1600887 AGAGAGAAAGAGTTGGAGGGAGG + Intergenic
1077721945 11:4638413-4638435 AGAGAGAAAGAAGTTGAGCCTGG + Intergenic
1077854829 11:6113301-6113323 AGAGAGAAGGAATAACAGTCAGG + Intergenic
1077998194 11:7471985-7472007 AGAAAGAAAGAAAAAGAGGGAGG + Intergenic
1078029018 11:7729680-7729702 AGAGAGAGAGAATGTAAGGAAGG + Intergenic
1078141879 11:8699104-8699126 AGGGAGAAAGGATAAGAGCCTGG + Intronic
1078208176 11:9248402-9248424 AGAGAGAGAGAAGCTGAGGTAGG + Intronic
1078697574 11:13649705-13649727 AGAGAGAAAGGATAAAAGGGTGG - Intergenic
1079184417 11:18223272-18223294 AGAGAGAAAGAAAAAGAGAGAGG + Intronic
1079304582 11:19311105-19311127 ATTGAGAAAGATTCTGAGGCTGG + Intergenic
1079603241 11:22337284-22337306 AGAGATAAAGAAAAAGAGGTGGG - Intergenic
1079644908 11:22851127-22851149 AGAGACAAAGATTATGGGGTTGG + Intronic
1079840094 11:25386124-25386146 AGAGAGAAAGTATATCATGGAGG + Intergenic
1080112584 11:28585096-28585118 AAAGAGAAAGTCTATGGGGCTGG - Intergenic
1080119874 11:28664786-28664808 AGAGAGAAAAAAGGAGAGGCTGG + Intergenic
1080165818 11:29235007-29235029 ATAGTGAAAGATTATGTGGCTGG - Intergenic
1080537301 11:33234350-33234372 AAAGAAAAAGAAAATTAGGCCGG + Intergenic
1080594941 11:33764336-33764358 AGAGGGAAGGACTATGAGGAGGG + Intronic
1080863893 11:36176251-36176273 AAAGAGAAAGAATATCAGAATGG - Intronic
1080999403 11:37649925-37649947 AGAGAGAGAGAATTGGAAGCTGG - Intergenic
1081174754 11:39913728-39913750 AAAGATAAATAAGATGAGGCAGG + Intergenic
1081380227 11:42405953-42405975 AGAGAGAAAGAAGAGGAGAAAGG - Intergenic
1081882872 11:46468841-46468863 AGAGAGAAAGAAAAGGAGGAAGG + Intronic
1081949372 11:47029964-47029986 AGAAAGAAAGAAAATTAGCCGGG + Intronic
1082072428 11:47949892-47949914 AGAAAGAAAGAAAAAGAGGCTGG + Intergenic
1082283068 11:50291373-50291395 TAAGTGAAAGAATATGAGGCCGG - Intergenic
1082626953 11:55497713-55497735 ATAGTGCAAGAATATGATGCTGG - Intergenic
1082745450 11:56956230-56956252 AGAGAGGAAGAATAAAAGGGAGG + Intergenic
1082814192 11:57497553-57497575 AGAGAAAAAGAATCAGAGGCAGG + Intronic
1083041368 11:59690700-59690722 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1083046985 11:59745647-59745669 AGAGAGAGAGAAAATTTGGCAGG - Intronic
1083606169 11:63980141-63980163 AGAAAGAAAGAAAAGAAGGCTGG - Intronic
1083657591 11:64237112-64237134 AGAGAGAGAGAGTAGGATGCTGG + Intronic
1083696166 11:64444139-64444161 AGAAAGAAAGAAAATGGGTCAGG - Intergenic
1084230777 11:67751104-67751126 AGAAAGAAAGAAGAGGAGGAAGG + Intergenic
1084279321 11:68076939-68076961 GGAGAGGAAGAAAATGAGGCCGG + Intronic
1084586137 11:70063823-70063845 AGAGAGCAAGATTCAGAGGCAGG - Intergenic
1084731995 11:71079802-71079824 AGAGAGAAAGAAAAAGAGAAAGG + Intronic
1085064166 11:73476980-73477002 GGAGAGAAAGAAAATTAGGTGGG + Intronic
1085137830 11:74109774-74109796 AAATAAAAAGAATTTGAGGCCGG + Intronic
1085235165 11:75008994-75009016 AAAGAGAAAAAACATGAGGCAGG - Exonic
1085296742 11:75435668-75435690 AGGGAGACAGAATGTGAGTCGGG + Intronic
1085673350 11:78490518-78490540 AGAAAAAGAGAAAATGAGGCTGG + Intronic
1085969961 11:81576774-81576796 AGAGAGGCTGAATAGGAGGCTGG + Intergenic
1086088962 11:82985629-82985651 AGAGAGAAAAAAAATGAGAGTGG + Intronic
1086270843 11:85064875-85064897 AGAGAGAAAGAGAGAGAGGCTGG - Intronic
1086774414 11:90812359-90812381 ACAGAGAAAGACTGTGAGGATGG + Intergenic
1086914230 11:92510377-92510399 CCAGAGAAAGGATTTGAGGCTGG + Intronic
1087144458 11:94798465-94798487 TGACAGAAAGTAGATGAGGCAGG + Intronic
1087276943 11:96170235-96170257 AGGGAGAAATAATAAAAGGCTGG - Intronic
1087461300 11:98452293-98452315 AGAGAGAGAGAGGAGGAGGCAGG - Intergenic
1087474183 11:98617124-98617146 GGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1087522116 11:99252088-99252110 AGAGATAAAGAAAATCAGGAGGG - Intronic
1087524318 11:99289445-99289467 AGAGAGAAAGGATATTAAGTAGG - Intronic
1087906412 11:103703157-103703179 AGAGGAAAAGAATATGATGAGGG - Intergenic
1088029322 11:105227301-105227323 AGAGAGAATGAATGTGAGTAAGG + Intergenic
1088483575 11:110319808-110319830 AGAGCCAGAGAATCTGAGGCTGG - Intergenic
1089012858 11:115144832-115144854 AGAGAGAGAGAAGATGAGGGAGG - Intergenic
1089570404 11:119404269-119404291 AAAGAAAAAGAATAAGAGGAGGG - Intergenic
1089825606 11:121273582-121273604 AGAAAGAAAGAAAAGGAGGGAGG - Intergenic
1089902637 11:122003814-122003836 AGAGAGAAAGAAAATGATAGAGG + Intergenic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090019630 11:123116206-123116228 AGAGAGGAATATTAAGAGGCAGG + Intronic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090628749 11:128627875-128627897 AGAGAGAAAGAATGACAGGGAGG + Intergenic
1091218175 11:133916276-133916298 AGAGAGAAAGGAGGAGAGGCAGG + Intronic
1091307576 11:134546564-134546586 AGAGAGATAAAAAATGATGCAGG + Intergenic
1091462194 12:652432-652454 AGAAAGAAGGAAAATGAAGCTGG + Intronic
1091500740 12:1015058-1015080 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1091690293 12:2591643-2591665 AGAGAGAGAGAGCATGAGGAAGG + Intronic
1092328139 12:7555973-7555995 ATAGAAACAGGATATGAGGCAGG + Intergenic
1092366869 12:7883560-7883582 AAAGAAAAAGAAAAAGAGGCCGG - Intronic
1092617393 12:10227693-10227715 AAAGGAAAAGAAAATGAGGCAGG - Intergenic
1092756392 12:11767217-11767239 AGAGATAAGGAAACTGAGGCTGG - Intronic
1092884649 12:12914507-12914529 AGAGAGAAAGAAAGTGGGGGGGG - Exonic
1093091520 12:14926394-14926416 AAAGACAAAGATTATCAGGCTGG - Intronic
1093124416 12:15311248-15311270 AGAGAGAAAGAAAGAGAGGAAGG - Intronic
1093191376 12:16078741-16078763 AGTGAGAAATAATGTAAGGCTGG + Intergenic
1093346425 12:18041465-18041487 AGAGAGAAAGAATGAGAGTGAGG + Intergenic
1093388986 12:18594349-18594371 AGAGAGAAAGTATATTAGAAAGG - Intronic
1093663372 12:21783441-21783463 AGAGAAAGAGAAAATGAGGAGGG - Intergenic
1093963304 12:25299176-25299198 AGAGAGATATAATATGAATCTGG - Intergenic
1094155797 12:27335713-27335735 AGAGAGAAAGAGTGAGAGGAGGG + Intronic
1094793293 12:33939601-33939623 AGAGAGAAAGAATGAGAGAAGGG - Intergenic
1095196872 12:39329562-39329584 AGAGGGAAAGAAGAGGAGGACGG + Intronic
1095258801 12:40074461-40074483 AGAAATGAAGAATATGGGGCTGG - Intronic
1095320853 12:40824501-40824523 AGAGATGAAGAAATTGAGGCAGG + Intronic
1095657674 12:44689471-44689493 AGAGAGATATAATATGATGATGG - Intronic
1096033574 12:48443143-48443165 AGAGAGAGAGAATCTAAGGTTGG - Intergenic
1096097850 12:48948820-48948842 AGAAAGAAAGAAAATGATGAGGG + Intronic
1096690700 12:53319823-53319845 AAAGAAAAAGAAAATGAGCCGGG + Intronic
1096727715 12:53578484-53578506 AGAGAGAAGGAAAATGAGCTAGG + Intronic
1097511143 12:60541972-60541994 AGAGAGAAAGAAAATGATATAGG + Intergenic
1097652465 12:62318513-62318535 TGAGATAAAGAATATGAAGAAGG - Intronic
1097809497 12:64003053-64003075 AGAGAGAAAGAAAGGGAGGGAGG + Intronic
1097987442 12:65798838-65798860 AGAGAGAGAGAAAAAGAGGAAGG + Intergenic
1098086436 12:66849327-66849349 AGAGAGAAAGGAATTGATGCTGG - Intergenic
1098328192 12:69324405-69324427 AGAGAGAAAGAAAATAAAGAAGG + Intergenic
1098442695 12:70534968-70534990 AGACAGAAAAAACATGAGTCCGG + Intronic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1098719555 12:73879656-73879678 AGAGAGAGAGAATATAATGATGG - Intergenic
1099010363 12:77284292-77284314 AGAAAGAAAGAAATGGAGGCAGG + Intergenic
1099330759 12:81283023-81283045 ACACAGAAAGAATCTGAGGAAGG - Exonic
1100316596 12:93450347-93450369 AGAGAGAAAAAATGGGAGGAGGG + Intergenic
1101163668 12:102006061-102006083 AGAGAGGCAGAATATAAGGCTGG + Intronic
1101380175 12:104207593-104207615 ATAGAGAAAGAATTTGAAGCTGG - Intergenic
1101387170 12:104268150-104268172 AGAGAGAAAGAGGAAGGGGCCGG - Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1101691966 12:107091326-107091348 AGAGAGAAAGAAAAGGAGTTAGG - Intronic
1101851535 12:108406948-108406970 AGAGAGAGAGAGAATGAGGCAGG + Intergenic
1101890100 12:108705888-108705910 ACAGAAAAAGCATTTGAGGCTGG + Intronic
1101964606 12:109273877-109273899 AGAGAGAGAGAGACTGAGGCAGG - Intergenic
1102868084 12:116390039-116390061 AAAGAGAATGAATAAGAAGCTGG + Intergenic
1102886384 12:116525262-116525284 AGAGAGAAAGAAAAGGAAGAAGG - Intergenic
1102968402 12:117146944-117146966 AGAGAAATAGAAAATAAGGCTGG + Intronic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1103357642 12:120333471-120333493 AGAGAGCAGGAATCAGAGGCAGG - Intergenic
1103395401 12:120603084-120603106 AGAAAGAAAGAATAACAGCCTGG + Intergenic
1103730112 12:123021780-123021802 AGAAAGAAAGAAAAAGAGGAGGG - Intronic
1103746402 12:123127593-123127615 AAAAAGAAAGAAAAAGAGGCAGG - Intronic
1104328298 12:127820684-127820706 AGCAAGAAAGAGTAGGAGGCAGG - Intergenic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1104571972 12:129933680-129933702 AGCATGAAAGAATCTGAGGCAGG - Intergenic
1104585399 12:130044574-130044596 AGAATGAAAGAATCCGAGGCAGG + Intergenic
1104604331 12:130176940-130176962 TAAGAGAAAGAAAATGGGGCTGG + Intergenic
1104668864 12:130667018-130667040 GGAGAGAAAGAAGAAGAGGGAGG + Intronic
1105019592 12:132807323-132807345 AGTGTGAAAGAAAATGAGGATGG - Intronic
1105457524 13:20555167-20555189 AGAAAGAAAGAAAATGGGGAGGG - Intergenic
1105515949 13:21090868-21090890 AGAAGGAAAGAAAAAGAGGCCGG - Intergenic
1105685851 13:22781064-22781086 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1105860639 13:24408648-24408670 AGAGAGACAGAGTATTAAGCTGG - Intergenic
1105945584 13:25186892-25186914 AGAAAGAAAGAAAAGGAGGGAGG - Intergenic
1105984796 13:25554965-25554987 AGAGAGAGAGAACAAGAGACAGG - Intronic
1106112886 13:26792423-26792445 CGTGAGAAAGGATAAGAGGCAGG - Intergenic
1106186478 13:27414255-27414277 AGAAAGAAAGAAAATTAGCCAGG - Intergenic
1106356807 13:28991105-28991127 GCAGAGAAACAACATGAGGCAGG + Intronic
1106546191 13:30732857-30732879 AGAGAGAAAAAAGAGGGGGCCGG + Intronic
1107034907 13:35891845-35891867 AGAGTGAAAGAATTTGAGAAGGG - Intronic
1107101477 13:36597988-36598010 AGAGAGAAAGAAAAAGAGGGAGG + Intergenic
1107118763 13:36775970-36775992 AGAGAGAGAGCATATGAAGGAGG + Intergenic
1107209257 13:37832980-37833002 AGAGAGAAATTATAAGAAGCAGG - Intronic
1107236356 13:38175636-38175658 ATAGAGAAAGAATTTAATGCAGG + Intergenic
1107266416 13:38561249-38561271 AGGGAGATAGAATATGAAGTTGG - Intergenic
1107545945 13:41433924-41433946 AGAGAAAAAAAAAATGAGCCGGG - Intergenic
1107939906 13:45374363-45374385 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1107969031 13:45623359-45623381 ACAAAGGAAGAATTTGAGGCTGG + Intergenic
1107998738 13:45887578-45887600 AGAGAGAAATAAAATGATGATGG + Intergenic
1108019670 13:46114043-46114065 AGAAGGAAAGAAAATGAGGTCGG - Intergenic
1108110902 13:47071429-47071451 AGAGAAGAAGAATATGAGTACGG - Intergenic
1108356551 13:49633644-49633666 AGAGAGGAAGAATTTGAAGAGGG + Exonic
1109374567 13:61474456-61474478 AGAGAGTAAAAATATTAAGCTGG + Intergenic
1109749961 13:66677606-66677628 AGAGAGAAAGAGCATGGGGAAGG - Intronic
1110271337 13:73594237-73594259 AGAGAGAGAGAGAATGTGGCTGG - Intergenic
1110609423 13:77472440-77472462 AGAGAGAAAGAATTGTGGGCAGG + Intergenic
1110632325 13:77723434-77723456 AGGGAAAAAGGATATGTGGCAGG + Intronic
1110637925 13:77787899-77787921 AGAAAGAAAGAAAATTAGCCAGG - Intergenic
1110948763 13:81458522-81458544 AGAGAAAAAAAATATGAGTTTGG + Intergenic
1111158585 13:84362066-84362088 AGAGGAAAGGAATATGAGGAGGG - Intergenic
1111320021 13:86614874-86614896 AGAGAGAGAGAGCAGGAGGCAGG - Intergenic
1111355454 13:87095318-87095340 AGAGAGAGAAAAAATGAGGTTGG - Intergenic
1111408205 13:87838007-87838029 AGAGTGAAAGGAAATGAGGCAGG + Intergenic
1111456862 13:88495884-88495906 TGAGAGAATAAATATGAGGAAGG + Intergenic
1111497872 13:89076777-89076799 AGAAAGAAAGAAAAAGAGGAAGG - Intergenic
1111962398 13:94825818-94825840 AGAGAGAATGCAGATGAGGCAGG - Intergenic
1111977036 13:94977252-94977274 AGAGAGAAAGAAGCTGGGCCTGG + Intergenic
1111977041 13:94977328-94977350 AGAGAGAGAGAAGATGGGCCTGG + Intergenic
1112227065 13:97550231-97550253 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1112299803 13:98219627-98219649 AGAAATAAAAAATATGTGGCTGG - Intronic
1112853398 13:103734678-103734700 AGAGAGAAAGGATAGAAGGAAGG + Intergenic
1113088754 13:106595531-106595553 AAACACAAAGAATATGAGGAAGG + Intergenic
1113159584 13:107364945-107364967 AGGGAGAGAGAAAATGAGGAGGG - Intronic
1113217428 13:108058719-108058741 AGGGAGAAAGAAAGGGAGGCAGG + Intergenic
1113261300 13:108566700-108566722 AGAGAGAAAGGAAAGGAGGAAGG + Intergenic
1114674029 14:24429476-24429498 AGAGAGGAAGAGTAGGAGGAAGG - Exonic
1114703687 14:24705019-24705041 AGTGAGGTAGAATCTGAGGCTGG + Intergenic
1114733255 14:25017258-25017280 AGGGAGAAAGAATATGAAATAGG + Intronic
1114767443 14:25390118-25390140 TGAGAGAAAGGAAATGAGGATGG + Intergenic
1114990802 14:28286183-28286205 AGGGTGAAAGAATATGAGATGGG - Intergenic
1115062310 14:29207994-29208016 AGAGGGAAAAACTCTGAGGCAGG - Intergenic
1115257960 14:31422524-31422546 AGAGAGAGAGAATTTAAGGCTGG - Intronic
1115263426 14:31476224-31476246 AGAAAGAAAGAAAAAGAGGAAGG - Intergenic
1115382759 14:32758435-32758457 AGAAACAAAAAAAATGAGGCTGG + Intronic
1115810076 14:37097584-37097606 AGACAAAAATAATATCAGGCAGG + Intronic
1116154038 14:41180691-41180713 AGAGAGAAAACAATTGAGGCAGG + Intergenic
1116579665 14:46623419-46623441 AAGGAGAAAGAATGTGTGGCTGG - Intergenic
1116631158 14:47335798-47335820 AGAGAGACAAAATTTGAAGCAGG + Intronic
1117013038 14:51490398-51490420 AGAGAGACAGAATATGAGGGAGG + Intronic
1117469552 14:56028491-56028513 CTAGAGCAAAAATATGAGGCTGG - Intergenic
1117928836 14:60815509-60815531 AGACTAAAAGAATATGCGGCTGG - Intronic
1118054928 14:62069915-62069937 AGAGGAAAAGAAAATGAGGCAGG + Intronic
1118140180 14:63072206-63072228 ATAGAGAAAGACTATCAGGTTGG + Intronic
1118508521 14:66443851-66443873 AGAGAGAAAGAGTTTGGGGAAGG + Intergenic
1118542283 14:66841742-66841764 AGATATTAAGTATATGAGGCCGG + Intronic
1118901180 14:69987237-69987259 AGCCTGAAAGAATATGAGGGAGG + Intronic
1119110668 14:71970950-71970972 AGAGAGAAGGTGTAGGAGGCAGG + Intronic
1119418753 14:74493691-74493713 GGAGAGAACGAACAGGAGGCCGG - Intronic
1119557571 14:75565476-75565498 AGAGAGACAGAACAGGGGGCTGG - Intergenic
1120333647 14:83125710-83125732 ACAGAGAAAGAAGAGGAGGAAGG - Intergenic
1120628204 14:86855815-86855837 AGAGATAAAGAATGTAATGCAGG + Intergenic
1120739517 14:88092127-88092149 GGAGTGAAAGCATATGGGGCGGG - Intergenic
1120760056 14:88276682-88276704 AGAGAGAAGGAATATTATACAGG - Intronic
1120868746 14:89318453-89318475 TGAGAGAAAGAAAAAGGGGCCGG - Intronic
1120896802 14:89540436-89540458 AGTTACAAAGAAAATGAGGCTGG + Intronic
1121264571 14:92591840-92591862 AGAGAGAAAGAAAATGATAAAGG + Intronic
1121270163 14:92632539-92632561 ATAGATAAAGAAACTGAGGCTGG + Intronic
1121451762 14:94012448-94012470 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121915411 14:97833307-97833329 AGAGAGAGAGAAGAGGAGGGGGG + Intergenic
1121915982 14:97837318-97837340 AGAGAGAAAGAAAAGGAGGAAGG + Intergenic
1121942309 14:98082801-98082823 AGGGAGAAAGAATTTCAGACTGG + Intergenic
1122199731 14:100115177-100115199 AGACAGAAAGAATATTCTGCAGG + Intronic
1122315405 14:100823525-100823547 AGAAAGAAAGAAAATGATGAGGG - Intergenic
1122654947 14:103251932-103251954 AGAAAGAAAGAGTTTAAGGCCGG - Intergenic
1123193776 14:106596974-106596996 AGATGGGAAGAATATGAGTCAGG + Intergenic
1123950000 15:25262095-25262117 AAAGAAAAAGAAAAAGAGGCCGG + Intergenic
1124045067 15:26141139-26141161 AGTGAGAAAGAAAGTGTGGCTGG + Intergenic
1124045208 15:26142546-26142568 AGAGAGAAAGAAAGAGAGGGAGG - Intergenic
1124493204 15:30171142-30171164 AGAGAGAAATAATCCGAGGCAGG - Intergenic
1124750330 15:32367183-32367205 AGAGAGAAATAATCCGAGGCAGG + Intergenic
1124803682 15:32860133-32860155 AGAGAGAAAGAAAAAGAGGAAGG + Intronic
1125166157 15:36707276-36707298 AGAGAGAAAGAGTGAGAGGGAGG + Intronic
1125467807 15:39972060-39972082 TAAAAGAAAGTATATGAGGCCGG + Intronic
1125933274 15:43615028-43615050 AGAGAGTGAGAATTGGAGGCTGG - Intronic
1125946372 15:43714490-43714512 AGAGAGTGAGAATTGGAGGCTGG - Intergenic
1126006324 15:44261300-44261322 AGAGGGAGAGAAAATGTGGCGGG + Intergenic
1126222168 15:46226488-46226510 AGAGAGAAAGGCTGTGAAGCTGG - Intergenic
1126266573 15:46761957-46761979 AGAGAGAAAGAAGATGAAACAGG + Intergenic
1126323012 15:47445610-47445632 AGAAAGAAGGAATATTATGCAGG - Intronic
1126348531 15:47720387-47720409 AGAGAGAAAGAAGAGGAAGACGG - Intronic
1126558270 15:50015237-50015259 ATAGAGAAAGAAAATGAAGAGGG + Intronic
1126610788 15:50527501-50527523 AGAAATAAAGAATCTCAGGCCGG - Intronic
1126930046 15:53637754-53637776 AGGGAGAGAGAATATGGGGCTGG - Intronic
1127428590 15:58880498-58880520 ACAGAGAAAGAAACTGAGGGTGG + Intronic
1127536342 15:59893336-59893358 AGAGACAAAGAATTTGAGGTGGG + Intergenic
1127765731 15:62184203-62184225 AAAGAGAAAGAAAATAAGGAAGG + Intergenic
1127774157 15:62252583-62252605 TGATAGAAAGAAACTGAGGCAGG - Intergenic
1127775778 15:62263462-62263484 TGATAGAAAGAAACTGAGGCAGG - Intergenic
1127818232 15:62631724-62631746 AGAGAGAAAGAAGAAAAAGCGGG - Intronic
1127929159 15:63579535-63579557 TCAGGGAAAGGATATGAGGCAGG - Intronic
1128276974 15:66361987-66362009 AAATAGAAAGAAATTGAGGCTGG + Intronic
1128340997 15:66822474-66822496 TGGGAGAAAGAATCTAAGGCTGG - Intergenic
1128666053 15:69539132-69539154 TGAGAGGAAGAGTGTGAGGCAGG - Intergenic
1128832272 15:70780286-70780308 AGAAAAAAAGAATGGGAGGCAGG + Intergenic
1129442254 15:75589835-75589857 AGAAAGAATGAATAAGAGCCAGG + Intergenic
1129654271 15:77513296-77513318 AGAGAGAAAGAGAAAGAGACAGG - Intergenic
1129875426 15:78972389-78972411 AAAGAAAAAAAACATGAGGCCGG - Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1129889512 15:79062505-79062527 AGACAGAAAGTAGATGAGGTTGG - Intronic
1129927438 15:79377307-79377329 AGAGAGAGAGAATGTGGGGAGGG + Intronic
1130133541 15:81162881-81162903 ATAAAAAAATAATATGAGGCCGG + Intronic
1130167122 15:81472847-81472869 AGACAGAAAGAATAAGAAACAGG - Intergenic
1130760799 15:86817601-86817623 AGAGAGAGAGAAAAAGAGACAGG + Intronic
1131526111 15:93153922-93153944 AGATAGAAAGAGTTTTAGGCTGG - Intergenic
1131646106 15:94346700-94346722 AGAAAGAAAGATTGTGAGCCTGG + Intronic
1131902159 15:97099655-97099677 GGAGAGAAAGACCATGAGCCAGG - Intergenic
1131940732 15:97562124-97562146 AGAGAGAAAGTAGATGGGGAGGG + Intergenic
1132158999 15:99519377-99519399 AGAGAGACAGACTACAAGGCAGG - Intergenic
1132188323 15:99824786-99824808 AGAGATTAAGAAAATGAGGTAGG + Intergenic
1132535398 16:476792-476814 AGAAAGAAAAAATTTTAGGCTGG + Intronic
1132918119 16:2365515-2365537 AGAGAGACAGAAAATAAGGGAGG - Intergenic
1133389885 16:5401730-5401752 AGAGAGAGAGAAAAAGAGACAGG - Intergenic
1133419130 16:5630680-5630702 ATAGAAAAAGAATAAGAAGCCGG - Intergenic
1133572629 16:7056573-7056595 AGAGAGAAATAAAATGATCCTGG + Intronic
1133609857 16:7423120-7423142 AGAGAGAGAGAATATGAATATGG + Intronic
1133852063 16:9514605-9514627 AGAGAGAAAGAACAGGAGAGAGG - Intergenic
1134281412 16:12820267-12820289 AGAAAGAAAGAAAAAGAGTCTGG + Intergenic
1134316808 16:13126536-13126558 AGAGAGAAAGAGACTGAGGGAGG + Intronic
1134410962 16:14003000-14003022 AGAGAGAGAAAAGATGAGACAGG + Intergenic
1134490979 16:14694975-14694997 AGAGAGAGAGACACTGAGGCTGG + Intergenic
1134496360 16:14734093-14734115 AGAGAGAGAGACACTGAGGCTGG + Intronic
1134624352 16:15713423-15713445 AGAGAGTGAGAAGATGAGGGAGG + Intronic
1134663228 16:15999760-15999782 AGAGAGAGAGAGAAAGAGGCCGG - Intronic
1134794497 16:17022551-17022573 AAATAAAAAGAACATGAGGCTGG - Intergenic
1135119613 16:19754216-19754238 AGAGATAAAGAAAATGAGTAAGG - Intronic
1135265062 16:21017775-21017797 GCAGAGAAAGAGTATGTGGCAGG + Intronic
1135669213 16:24360862-24360884 AGAGAGAAAGACTAAGAACCTGG - Intronic
1135754163 16:25082606-25082628 AGTTAGATTGAATATGAGGCTGG + Intergenic
1135791502 16:25400805-25400827 AGATAGAAGAAACATGAGGCAGG - Intergenic
1136558032 16:31020196-31020218 AGAGATTCAGCATATGAGGCTGG - Intergenic
1136698217 16:32105693-32105715 AGAAAGAAAGAATATGAGAAAGG + Intergenic
1136798718 16:33048986-33049008 AGAAAGAAAGAATATGAGAAAGG + Intergenic
1137340092 16:47593095-47593117 AGAAAGAAAGAAAAAGAGGGGGG + Intronic
1137885167 16:52095342-52095364 AGAAAGAAAGAAAATGAGCCAGG + Intergenic
1138483217 16:57317924-57317946 ACAGAGAAGGAAACTGAGGCTGG - Intergenic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1138571568 16:57877258-57877280 GGAAAGGAAGAAAATGAGGCCGG - Intergenic
1138600775 16:58052695-58052717 AGAAAGAAAGAAAATTAGCCGGG - Intergenic
1138703101 16:58885903-58885925 AGAGAAAAAGAAAATGAGGCAGG + Intergenic
1138827423 16:60337149-60337171 AGAAAGAAAGAAAATAAGGAAGG + Intergenic
1139054231 16:63162360-63162382 AGAAAGAAAGAAAAAGAGGGAGG - Intergenic
1139070298 16:63372195-63372217 AGAGAGAGAGAGTATTAGGATGG - Intergenic
1139119685 16:64000355-64000377 AAAGAAAAAGAATATGTTGCTGG + Intergenic
1139144499 16:64307625-64307647 AGAGAGAAGGAAAAGGAGGAAGG + Intergenic
1139246752 16:65452274-65452296 AGAGAGAGAGAAAAAGAGGGAGG + Intergenic
1139612288 16:68067576-68067598 TAATAGAAAGAAAATGAGGCTGG - Intronic
1139906700 16:70371254-70371276 AGAGGGAAAGAATTTGGGACAGG - Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140108624 16:71983957-71983979 AGAAAAAGAGAATCTGAGGCTGG - Intronic
1140307092 16:73813214-73813236 AGAGAGAAAGAGAAAGAGGTAGG - Intergenic
1140328792 16:74031709-74031731 GGAGAGAGAGAATGTGAGGCAGG - Intergenic
1140347605 16:74229041-74229063 AGAGGGAAAAAATATGGGGATGG + Intergenic
1140437307 16:74958235-74958257 AAAGACAAAGAAAATGAGACAGG + Intronic
1140692611 16:77498820-77498842 AGAGAGAGAGAGTCAGAGGCGGG + Intergenic
1140703559 16:77605042-77605064 AGGGAGAAAAACTATGATGCAGG - Intergenic
1140740374 16:77936303-77936325 AGAGCTAAAGAAACTGAGGCTGG + Intronic
1140876173 16:79154379-79154401 AGAGTGAAAGAAGAGGAGACAGG - Intronic
1140898011 16:79342234-79342256 AGATAGAAAGAAAGTGAAGCAGG - Intergenic
1141155133 16:81592203-81592225 AGAGAGAAAGAATAAGAGAGAGG + Intronic
1141609840 16:85175138-85175160 AGAAAGAAAGAAGAGGAGGAGGG + Intronic
1141802313 16:86318397-86318419 AGAGATAAATACGATGAGGCTGG - Intergenic
1142145715 16:88492174-88492196 AGAGAGAGAGAAAGAGAGGCAGG - Intronic
1142259327 16:89035238-89035260 AGAGAGAATGAAGAGGAGGGAGG - Intergenic
1142467914 17:146583-146605 AGAGAGAAAGCCAATGGGGCCGG - Intergenic
1143183819 17:4998985-4999007 AGGGAGAAAGAAAAGGAAGCCGG - Intronic
1143286158 17:5790747-5790769 AGAGAGAGAGAGGATGAGGCGGG + Intronic
1143463539 17:7119950-7119972 TGAAAGAAAGAATACAAGGCTGG + Intergenic
1143488816 17:7271650-7271672 AAAGAGGAAGAAGATGAGCCAGG + Intergenic
1143493526 17:7297323-7297345 AAAGAAAAAGAAAATGGGGCGGG + Intergenic
1143539123 17:7559043-7559065 AGCAAGAAAGGAGATGAGGCTGG - Exonic
1143624278 17:8100108-8100130 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
1143703134 17:8676268-8676290 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1144095914 17:11900580-11900602 AGGGAAAAAGAAGATGAGGGAGG - Intronic
1144605591 17:16662777-16662799 AGTGATAAAGAATATCAGCCAGG - Intergenic
1145026358 17:19470774-19470796 TGAGAGATGGAAAATGAGGCAGG - Intergenic
1146633678 17:34488445-34488467 AGAGACAAAAACTATGGGGCTGG + Intergenic
1146876692 17:36419246-36419268 AGACAGAAAGAATATGAGGCAGG - Intronic
1147062692 17:37893615-37893637 AGACAGAAAGAATATGAGGCAGG + Intergenic
1147255592 17:39179600-39179622 AGAAAGAAAGAAAACTAGGCCGG + Intronic
1148014215 17:44509681-44509703 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1148512134 17:48180283-48180305 AGAGAAAAAGAAAATAAGACAGG + Intronic
1148870334 17:50655455-50655477 TGATAGAAAGAAAATGAGCCTGG + Intronic
1149387532 17:56156717-56156739 TAAAAGAAAGAACATGAGGCAGG - Intronic
1149398605 17:56270840-56270862 AGAAAGAAAGAATAAGATGGAGG - Intronic
1150037694 17:61821476-61821498 AAAGAGAATGAAATTGAGGCAGG - Intronic
1150958616 17:69890025-69890047 AGAGAGATGGAATATGAAGGGGG + Intergenic
1151096506 17:71505088-71505110 AGAGACAAAGAAAATGAAACAGG - Intergenic
1151483173 17:74382301-74382323 AGAAAGAAAGAAAGTGAGCCTGG - Intergenic
1151521337 17:74632498-74632520 ACAGAGAAATGATATGAGACAGG - Intergenic
1151981970 17:77517993-77518015 AGACAGAAAGGATATGGGGGAGG - Intergenic
1152784362 17:82240309-82240331 AGGGAGAAAGACGAGGAGGCAGG + Intronic
1153044204 18:840831-840853 AAAGAGGAAGAATAAGAGTCTGG - Intergenic
1153295406 18:3541238-3541260 AGAGAGAAAGAGAAGGAGGGAGG + Intronic
1153489829 18:5635565-5635587 TGAGAGAAAGAATATTATGAAGG - Intergenic
1153629717 18:7057773-7057795 AGAAAGAAAGAATTTTGGGCTGG - Intronic
1153715445 18:7842972-7842994 AGAGAGAGATTATATGAGCCAGG + Intronic
1153757715 18:8300815-8300837 TGAGAGGAAGATTAGGAGGCTGG - Intronic
1153831788 18:8930253-8930275 AGAGAGAAAGAGAAGGAGGGAGG + Intergenic
1154020860 18:10663023-10663045 AGCCAGGAAGAACATGAGGCAGG + Intergenic
1154021607 18:10668366-10668388 AGTGAAAAAGAATAAGGGGCAGG + Intronic
1154105101 18:11515909-11515931 AGAAAAAAAGAATAAGCGGCTGG + Intergenic
1154337003 18:13474066-13474088 GGAGAGAAAGAGCACGAGGCGGG - Intronic
1154388601 18:13917545-13917567 AGAGAGAAAGAGTGAGAGGGTGG + Intergenic
1154515866 18:15164755-15164777 AGAGAGAAAGAAAGTGAGAAAGG - Intergenic
1155344177 18:24842515-24842537 AGAGAGAAAGAAAGTGAGTCAGG + Intergenic
1155508980 18:26558575-26558597 ATAGATAAAGAAAATGTGGCTGG + Intronic
1155672070 18:28383817-28383839 TGAGAGAAAGAACAAGAGGCAGG - Intergenic
1156340150 18:36203346-36203368 AGAGAGCAAGAGAATGAGGTGGG + Intronic
1156568872 18:38228496-38228518 AGAAAGAAAGAATAAAAGGAAGG + Intergenic
1157068778 18:44381953-44381975 AGAGAGAGAAAATGTGAGGGGGG + Intergenic
1157124470 18:44942935-44942957 AGGGTGACAGAATATGAGGATGG + Intronic
1157358311 18:46955186-46955208 AGAGAGAAAGAAAAAGAGAGAGG - Intronic
1157888512 18:51392135-51392157 GGAGAGAAAGAAGATGAGTCTGG + Intergenic
1157957064 18:52110522-52110544 AGAGAGCAAGAGGAAGAGGCAGG - Intergenic
1158332116 18:56374512-56374534 TGAGAGAAAGAAGAAGAGGCAGG - Intergenic
1158360469 18:56666496-56666518 AGAAGGAATGAAGATGAGGCCGG - Intronic
1158552338 18:58446637-58446659 AGAGGGAGAGAGGATGAGGCTGG + Intergenic
1159323987 18:66892326-66892348 AGAAAGAAAGAAAAAAAGGCCGG - Intergenic
1159633969 18:70782907-70782929 AGAGAGGAAGAAAAAGAGGAAGG - Intergenic
1159824256 18:73187442-73187464 ACAGAGACAGACTATGAGCCAGG - Intronic
1160950437 19:1664327-1664349 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
1161111363 19:2472487-2472509 ACAGAGAAAGAAACTGAGGCTGG + Intergenic
1161525415 19:4751960-4751982 AGAAAGAAAGGAAATGAGGCCGG + Intergenic
1161635452 19:5385971-5385993 AGAGAGAAAGAAAGGCAGGCAGG + Intergenic
1161705282 19:5817611-5817633 AGAGAGAAAGAAAAAGAAGAAGG + Intergenic
1161758656 19:6153957-6153979 AGAGAGAAAAAAATTGAGGGTGG + Intronic
1161919557 19:7255873-7255895 ACAAAGAAAGAAGATGAGGTTGG - Intronic
1162215071 19:9127394-9127416 AGAGAGAAAGAAAGAGAGGGGGG - Intergenic
1162717057 19:12640786-12640808 AGAGAAAAGGAAAAAGAGGCCGG + Intergenic
1162841950 19:13363297-13363319 AGAGAGAATGAATATGGGGCAGG - Intronic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1162950527 19:14069634-14069656 AGAGAGAAAGAAAGGGAGGGAGG - Intergenic
1163082021 19:14950947-14950969 AAAAAAAAAGAAAATGAGGCAGG + Intronic
1163504183 19:17694973-17694995 AGAAAGAAAGAAAAAGAGGCCGG + Intergenic
1163727635 19:18931829-18931851 ACAGAGCAAGAAACTGAGGCTGG + Intronic
1163848834 19:19652295-19652317 GGAGAGAAGGAAGCTGAGGCTGG - Intronic
1164047344 19:21554080-21554102 CGAAAGAAAGGATATGAGACTGG - Intronic
1164654539 19:29910677-29910699 AGAGAGAAAGAAAAGGAAGAAGG - Intergenic
1164792482 19:31000153-31000175 AGAATAAAACAATATGAGGCTGG + Intergenic
1164917716 19:32065548-32065570 AGAGAGAGACCACATGAGGCAGG + Intergenic
1164932369 19:32185558-32185580 GGAGAGAAAGCATATGGAGCTGG + Intergenic
1165351139 19:35276674-35276696 TGAGAGAAAGACTCTAAGGCAGG - Intronic
1165400495 19:35596604-35596626 AGAGAGACAGGCTAGGAGGCGGG + Intergenic
1165428872 19:35760438-35760460 AGAGATAAATAAACTGAGGCTGG - Intronic
1165701684 19:37943003-37943025 AGAGAGAGAGAGAAAGAGGCTGG - Intronic
1166084128 19:40464061-40464083 AAAAAGAAAGAAAAAGAGGCTGG - Intronic
1166145127 19:40828949-40828971 AGAGAGAGACAATGTGAGGATGG - Intronic
1166215458 19:41331707-41331729 ACTGAGAAAGAAAATCAGGCGGG - Intronic
1166343174 19:42150653-42150675 AGAGAGAAAGGGCAGGAGGCAGG - Intronic
1166515925 19:43446911-43446933 AGAGAGCAGGGAGATGAGGCTGG - Intergenic
1166986598 19:46663797-46663819 AAAGAGAATGCAAATGAGGCCGG + Intergenic
1167014832 19:46834263-46834285 AGAGAGACAGAAAATGATGACGG - Intergenic
1167217687 19:48175645-48175667 AGAGAGAAGGGATATGAAGGAGG + Intronic
1167221502 19:48201814-48201836 AGAGAGAAAGGAAAGGAGGCAGG + Intronic
1167419668 19:49395504-49395526 AGACAGAAATAAAATGGGGCTGG + Intronic
1167484032 19:49749904-49749926 AGAGAGAGAAAAAAGGAGGCTGG - Intronic
1167739229 19:51314021-51314043 AGAAAGAAAGAAGAGGTGGCTGG - Intronic
1167753833 19:51397927-51397949 AGTGAGAAAAAAGCTGAGGCAGG - Intergenic
1167758895 19:51430983-51431005 AAAGAGAAAGAGTAGGAGGCTGG - Intergenic
1167864440 19:52313115-52313137 AAAGAGAAAGAATTATAGGCTGG - Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1168310447 19:55457241-55457263 AGACAGAAAGCAGATGGGGCCGG + Intronic
1168342141 19:55630928-55630950 AGAAAGAAAGAAAAAGAGACCGG - Intergenic
1202711457 1_KI270714v1_random:21530-21552 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
925355519 2:3238493-3238515 AGAGAGAAGGAATGTGAGGAAGG - Intronic
925654162 2:6126869-6126891 AGAGAGATAGGAAATGAGGTTGG + Intergenic
925721522 2:6833088-6833110 AGAGAGAAAGAAAGAGAGGGAGG + Intergenic
925726144 2:6874128-6874150 AGAGAGAAAGATGCTGGGGCAGG - Intronic
926010927 2:9407309-9407331 ATAGTGAATGAATATTAGGCCGG - Intronic
926036979 2:9643572-9643594 AGAAAGGAAGAGAATGAGGCTGG - Intergenic
926396398 2:12447002-12447024 TCAGAGAAAGAATATCAGACGGG + Intergenic
927068094 2:19493909-19493931 AGACTGAAAGAATATGTGCCTGG + Intergenic
927167963 2:20344342-20344364 TGTAAGAAAGACTATGAGGCTGG - Intronic
927744958 2:25610379-25610401 AGAGAGAGAGTATATGTGCCAGG + Intronic
927812246 2:26186559-26186581 AGAGAGAAAGAAGCTGAAGTGGG - Intronic
927838527 2:26421534-26421556 AGAGAGAAAGAAGAGGAGGGAGG - Intronic
927875858 2:26654841-26654863 AGAGAGAGAGAGAATGAGTCTGG + Intergenic
928226531 2:29453718-29453740 AAAGAGAAAGAAAAAGAGGAAGG + Intronic
928332893 2:30371153-30371175 AGGGTGAAAAAAAATGAGGCTGG + Intergenic
928422419 2:31149017-31149039 AGAGAGAGATAATATGAAGTAGG - Intronic
928644149 2:33334243-33334265 AGAGGGAAAGAAGGTGATGCAGG + Intronic
928871230 2:35982924-35982946 AGAGAAAAAGAAAAGGAGGAGGG + Intergenic
929073317 2:38056216-38056238 AGAGAGACACAATATCAGGGAGG - Intronic
929388855 2:41444108-41444130 GGAGAGGAAGAATAGGTGGCTGG + Intergenic
930200372 2:48547093-48547115 CTACAGAAAGAATATGGGGCTGG + Intronic
930218980 2:48726416-48726438 AGGTAGAGATAATATGAGGCAGG + Intronic
930366394 2:50445218-50445240 AGAGATAAAGAGTATCAGGAAGG + Intronic
930543782 2:52741194-52741216 AGAGAGTGAGAGTCTGAGGCTGG - Intergenic
930594016 2:53363725-53363747 AGGGAGAAAGAAAATGCTGCTGG + Intergenic
930676037 2:54201573-54201595 AGAAAGAAAGAAAAAGAAGCTGG - Intronic
930717269 2:54604689-54604711 AGCGAGAAAGAAGATGGGCCTGG + Intronic
930934080 2:56925562-56925584 AGAGAGGAAGAAAGTAAGGCAGG + Intergenic
931203839 2:60127748-60127770 ACAGAGCAAGAATAGGAGGGTGG - Intergenic
931214904 2:60232840-60232862 AAAGAGAAAGATTATCAGACTGG + Intergenic
931362521 2:61590054-61590076 AGAGAACAAGAAGATGAGCCGGG - Intergenic
931762369 2:65430172-65430194 ACAGAGAAGGAATATGCTGCTGG - Intronic
932053854 2:68425263-68425285 AGAGAAGAAGAAAATGAGGAAGG + Intergenic
932107029 2:68953314-68953336 AGAGGGAACGGATATGAGACGGG + Intergenic
932241693 2:70162304-70162326 AGAAAGAAAGCAAAAGAGGCTGG - Intronic
932401885 2:71486410-71486432 GGAGAGAAAGAATAAAAGGAGGG - Intronic
932513027 2:72314494-72314516 GGAGAGAAAAACTATGAGCCAGG - Intronic
932842751 2:75099057-75099079 AGTGAAAAAGAAGATGTGGCAGG - Intronic
932991252 2:76790470-76790492 AAAGAGGAAGAAACTGAGGCTGG - Intronic
933283180 2:80355152-80355174 AGAGAGAATGGATATGTGGTAGG - Intronic
933517431 2:83323223-83323245 AGAGAGCTAGAATGGGAGGCAGG - Intergenic
933811662 2:86036484-86036506 AAAGAGAAAGAAAAAGAGGGTGG + Intronic
933885250 2:86713297-86713319 AGAGAGAAGGAAAATGATGTAGG + Intronic
933924924 2:87083386-87083408 AGAGAGAAGGAAAATGATGTAGG - Intergenic
934789921 2:97050350-97050372 AGATAGAAAAAATATGAGGTGGG + Intergenic
934816546 2:97332189-97332211 AGATAGAAAAAATATGAGGTGGG - Intergenic
934821150 2:97376295-97376317 AGATAGAAAAAATATGAGGTGGG + Intergenic
934925950 2:98381834-98381856 AGACAGAAAGATAAGGAGGCAGG + Intronic
935209041 2:100922711-100922733 CAAGAGAAAGAAAATGAGCCTGG - Intronic
935231128 2:101097323-101097345 AGAGAGAAAGAAAATGACATAGG + Intronic
935409425 2:102744537-102744559 AGAAAGAAAGAATATGATATAGG - Intronic
935824272 2:106928452-106928474 AGAGAGAAAGAAAATGATACAGG - Intergenic
936012209 2:108932145-108932167 AGAAAGAAAGAAAAGGAGGAAGG - Intronic
936495431 2:113016238-113016260 AGAAAGTAAAAACATGAGGCTGG + Intergenic
936886137 2:117311410-117311432 GGAAAGAAAGAATAAAAGGCAGG - Intergenic
937089322 2:119195520-119195542 AGAGAGAAAGAAATAGAGGGGGG + Intergenic
937272993 2:120666389-120666411 AGAAAGAAGGAATATGATGAAGG - Intergenic
937666269 2:124490364-124490386 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
938164147 2:129011453-129011475 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
938342040 2:130542024-130542046 AGAGAGAAAGAAAAAGAGGGAGG + Intronic
938347792 2:130578687-130578709 AGAGAGAAAGAAAAAGAGGGAGG - Intronic
938402527 2:131005157-131005179 AGAGAGGAAGAGGATGGGGCTGG + Intronic
938741877 2:134239856-134239878 AGAGAATAAGAAAATGAGTCAGG + Intronic
938919523 2:135982270-135982292 TGAGAGAAACAACATGAGTCAGG + Intronic
938955956 2:136298487-136298509 AGAGAGAAAGAATATGACTCAGG - Intergenic
939236290 2:139498198-139498220 AGAGAGAGAGAATATAAGATCGG - Intergenic
939733596 2:145815845-145815867 AGAGAGAAAGAAAAAGAAGAAGG + Intergenic
940164734 2:150757868-150757890 AGAGAAAAACAAAAAGAGGCAGG - Intergenic
940287801 2:152049602-152049624 GGAGAGAGAGAAAATGAGGAAGG - Intronic
940301774 2:152182778-152182800 AGAGAGAAAGAATATGATGCAGG - Intergenic
940373030 2:152923223-152923245 AGGGAGAGAGAAAGTGAGGCAGG - Intergenic
940682247 2:156801914-156801936 AGAGATAATGAATATCAGGAAGG + Intergenic
940776950 2:157894782-157894804 ACAGAGAAGGAACCTGAGGCAGG + Intronic
941083626 2:161091146-161091168 AAAGACAAAGAAACTGAGGCTGG - Intergenic
941102905 2:161316845-161316867 AGAGAGAAAGAAAATCTGGCAGG - Intronic
941225178 2:162838997-162839019 GGAGAGAGAGAAAAGGAGGCTGG + Intergenic
941267263 2:163378158-163378180 AGAGAGAAAGAATATGGCATTGG - Intergenic
941283587 2:163581970-163581992 AGGAAGAAAACATATGAGGCTGG + Intergenic
941378123 2:164756060-164756082 AGAGAGAGAGAGAATGAGGGAGG + Intronic
941817610 2:169813423-169813445 AGAAATAAAGAATTTCAGGCCGG - Intronic
941821134 2:169844293-169844315 AAAGAAATCGAATATGAGGCCGG - Intronic
941865669 2:170331892-170331914 AGAAAGAAAAAAGAAGAGGCAGG - Intronic
942074623 2:172345340-172345362 ACAGAGAAAGAGAACGAGGCTGG + Intergenic
942223269 2:173791845-173791867 AGAGAGAAAGAAACAGAGGAAGG - Intergenic
942230886 2:173860088-173860110 AGAGAGCCAGAAAATGAGGGGGG + Intergenic
942253665 2:174070117-174070139 ACATAGGAAGAATATAAGGCCGG + Intergenic
942448314 2:176092801-176092823 AGAGAGAAAGGAGAGGAGGGAGG + Intergenic
942554623 2:177158777-177158799 AAAGAGAAAAAATATATGGCAGG + Intergenic
942895763 2:181052337-181052359 AGAGAAAAAGAGGATGAGGAAGG - Intronic
943373359 2:187044597-187044619 CGAGAGCAAGAAAGTGAGGCAGG - Intergenic
943978996 2:194522827-194522849 AGAGAGACAGGAGATGAGGAAGG + Intergenic
944170489 2:196771606-196771628 AGAGATCAAGAAACTGAGGCAGG + Intronic
944345789 2:198664251-198664273 ACAGAGAGAGAAAATGAGGGAGG - Intergenic
944526683 2:200626727-200626749 ACAAAGAAGGAATATGGGGCTGG + Intronic
944964446 2:204914461-204914483 AGAGAGAAAGAATGGAAGGAGGG + Intronic
945101889 2:206269892-206269914 AGAGAGAAAGGAAAGGAGGAAGG - Intergenic
945130327 2:206564024-206564046 AGAAATAAAGAATTTTAGGCCGG - Intronic
945309361 2:208293415-208293437 AGAGAGAAGGAATATGATATAGG - Intronic
945639624 2:212407416-212407438 ACAGATAAAGAAACTGAGGCGGG + Intronic
945649314 2:212538840-212538862 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
946066751 2:216994478-216994500 AGAGAGAAAGGAGATGAAGAAGG - Intergenic
946128874 2:217589478-217589500 AGACAGAAAGAAAATGATACTGG - Intronic
946222499 2:218240247-218240269 TGAGAAAAAAAATATCAGGCTGG - Intronic
946230752 2:218289931-218289953 GGAAAGAAAGAGTAGGAGGCAGG + Intronic
946244633 2:218380054-218380076 TGAAAGAAAGAAAAAGAGGCCGG - Intergenic
946462585 2:219882229-219882251 AGAGAGAAAGAAAGAGAGGGAGG - Intergenic
946594407 2:221290281-221290303 AGAAATAAAGCATATAAGGCTGG + Intergenic
946598675 2:221335058-221335080 AGATAGAAAGAAAAGGATGCTGG - Intergenic
946599380 2:221342655-221342677 AAAAAGAAATAATATAAGGCAGG - Intergenic
946801281 2:223418546-223418568 ACAGAGAAAGAAAAGGAGGGAGG - Intergenic
946948546 2:224847750-224847772 AGAGTGAAAGAATGTCAGGCAGG + Intronic
947591383 2:231388132-231388154 ACAGAGAAGGAAACTGAGGCAGG - Intergenic
948217697 2:236244120-236244142 AGAAAGAAAGAAAAACAGGCCGG - Intronic
948477306 2:238228327-238228349 GGAGAGAGAAAATATGAGGCAGG + Intronic
948512269 2:238476517-238476539 AGAGAGGAGCAAAATGAGGCCGG + Intergenic
948986422 2:241527464-241527486 AGAAAGAAAGAAAAGAAGGCCGG - Intergenic
949029452 2:241785077-241785099 AGGGAGAATTATTATGAGGCTGG + Intronic
1168786570 20:544612-544634 AGAGTGGCAGAATAGGAGGCTGG - Intergenic
1168821521 20:776647-776669 ATAAAGAAAGACCATGAGGCTGG + Intergenic
1168910065 20:1440485-1440507 AGAGAGAAGAAAAATGAAGCAGG + Intergenic
1169009850 20:2241375-2241397 AGAAAGAAAGAAAAAGAGGGAGG - Intergenic
1169564713 20:6841375-6841397 AGAGAGGAAGAATAGAGGGCTGG + Intergenic
1169650320 20:7859532-7859554 ACAGAGAAAGAATATGGGGGTGG + Intergenic
1170583590 20:17717019-17717041 AGAAAGAATGAAAATGAGGGTGG - Intronic
1170633934 20:18088593-18088615 AGAGAGAGAGAGAAAGAGGCGGG - Intergenic
1170691276 20:18617663-18617685 AGAGAGCAAGAAAAACAGGCTGG - Intronic
1170792363 20:19518623-19518645 AGAGTGAGAGAATATGAGCGTGG + Intronic
1170868399 20:20181610-20181632 AGAGAGAAAGCATAAGAGAGAGG + Intronic
1170938704 20:20830986-20831008 AGAGAGAGAGAACATGAAGGTGG - Intergenic
1171038823 20:21740963-21740985 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1172680795 20:36713004-36713026 AGAGACAAACAAACTGAGGCAGG - Intronic
1172687759 20:36769957-36769979 AGAGAGAAAGAAAGTGAGGCGGG + Intronic
1173221069 20:41133671-41133693 AGAGAGAAAACATATCAGGTAGG + Intergenic
1173400876 20:42724786-42724808 AGAGAGAAAGAAGAAGAGATTGG - Intronic
1173463992 20:43266881-43266903 AGAAAGAAAAAATGGGAGGCGGG + Intergenic
1173876663 20:46376531-46376553 ACAGAGACAGAACATGAGACAGG - Intronic
1173881641 20:46417923-46417945 AGAGTGAAAAAAAATTAGGCAGG + Intronic
1174194709 20:48764801-48764823 AGAAAGAAAGAAAAAGAGGGAGG + Intronic
1174320339 20:49736836-49736858 AGAGAGAGAGAGAATCAGGCTGG - Intergenic
1174333279 20:49838184-49838206 AGAGAGAACGAAGATGGGGGTGG + Intronic
1174390586 20:50216296-50216318 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1174639670 20:52032779-52032801 AGAGAGAGAGAATATGATATTGG + Intergenic
1174900131 20:54490882-54490904 AGAGAGAAAGGAAAAGAGGCTGG - Intronic
1174921233 20:54704684-54704706 AGAGAGAAAGAAAATAAAGAAGG - Intergenic
1175105590 20:56612523-56612545 AGAAAGAAAGAAAGTAAGGCCGG + Intergenic
1175270307 20:57729313-57729335 AGAGAGTAAGTATCTTAGGCTGG - Intergenic
1175286792 20:57841899-57841921 GAAGAGAAAGCAAATGAGGCAGG - Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175293733 20:57894868-57894890 TGGGAGAAAGAAAATGAGGGAGG + Intergenic
1175310282 20:58006988-58007010 ACAGAGAGAGAGAATGAGGCTGG - Intergenic
1175686044 20:61029586-61029608 AGAGAGGAAGAGTAGGAGACAGG - Intergenic
1175695162 20:61097753-61097775 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
1175996041 20:62812755-62812777 AGAGAGCAAGAAGAGGAAGCTGG + Exonic
1176192245 20:63817416-63817438 ATAGAAAAAGAAAAAGAGGCCGG + Intronic
1176409045 21:6437814-6437836 AGAGACCAAGAACATGAAGCTGG + Intergenic
1176911594 21:14571778-14571800 AGACAAAAAGAAGAAGAGGCTGG - Intronic
1177148620 21:17432568-17432590 AGAAAGAAAGAATATTAGCTGGG + Intergenic
1177522767 21:22250747-22250769 AAAGAGAATGAATATATGGCAGG + Intergenic
1177641835 21:23853857-23853879 AGAGAGAGAGAAAATGAGAGAGG + Intergenic
1178253942 21:31033255-31033277 AGAGACAAAGGACAAGAGGCAGG - Intergenic
1178790099 21:35691948-35691970 AGAAAGAAAGAAAATAATGCAGG - Intronic
1178938224 21:36882599-36882621 AGAAAGAAAGAAAATTAGCCAGG - Intronic
1179090089 21:38256835-38256857 AGAGAGAAGGAATCTGAGAAAGG - Intronic
1179167414 21:38945509-38945531 AGAAAGAAAGAAACCGAGGCAGG + Intergenic
1179333789 21:40431100-40431122 AGAGATAATGAAGATGTGGCAGG - Intronic
1179381672 21:40905070-40905092 AGAAAGAAAGAAGATGAGCTAGG + Intergenic
1179382787 21:40914931-40914953 AAAGAGAAAGAATCTGAGATGGG + Intergenic
1179418198 21:41215161-41215183 AGAGAGAAAGGAATTGAGACGGG + Intronic
1179464582 21:41563094-41563116 AGAGAGAAACAAGATGGCGCAGG + Intergenic
1179684537 21:43046136-43046158 AGAGACCAAGAACATGAAGCTGG + Intergenic
1180416573 22:12723157-12723179 AGAGAAAAAGAGCATGAGACTGG + Intergenic
1180749900 22:18117056-18117078 ACAGAGAAAGAATAGGAGCACGG - Intronic
1180891923 22:19295109-19295131 AGAGAGAAAGGACATGAGAGAGG + Intergenic
1182000495 22:26915770-26915792 AGAGAGAAATGAAAGGAGGCTGG - Intergenic
1182229359 22:28825495-28825517 AGAAATGAAGAAAATGAGGCAGG + Intergenic
1182489627 22:30662666-30662688 AAAAAGAAAAAAAATGAGGCGGG + Exonic
1182781478 22:32871930-32871952 AGAAAGATAGAAAATGAGGATGG - Intronic
1183114872 22:35683991-35684013 AGAGAGAAAGAATGAGAGACAGG + Intergenic
1183129425 22:35819801-35819823 ACAGAGAAAAAATAAGAGGAGGG + Intronic
1183311141 22:37110013-37110035 TGAGAGAGAGAAAAGGAGGCTGG + Intergenic
1183319311 22:37155482-37155504 AGTGAGAAAGCACAGGAGGCAGG - Intronic
1183368208 22:37418280-37418302 AGACAGAAGGATGATGAGGCAGG + Intronic
1183553629 22:38507912-38507934 AAAGAAAAAGAATATGACCCAGG - Intergenic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
1184440877 22:44513912-44513934 AGAGAGAAAAAAAAGGAGGAGGG - Intergenic
1203322938 22_KI270737v1_random:86152-86174 AGAAAGAAAGAAAAGGAGGAAGG - Intergenic
949172591 3:1018988-1019010 AGAGAGAGAGGTTAAGAGGCTGG + Intergenic
949182874 3:1155813-1155835 AGAGAGAAACTGTAGGAGGCTGG - Intronic
949331947 3:2932750-2932772 AGAGAGAAAAAAAAGGAGGGAGG + Intronic
949390045 3:3551479-3551501 AGAGAGGAAAAATGTGATGCTGG + Intergenic
949618461 3:5783161-5783183 GGAGAGAAAAAGTAGGAGGCAGG - Intergenic
949674218 3:6434400-6434422 AGAGAGAGAGAAGGTGAAGCAGG + Intergenic
949746453 3:7298874-7298896 AGAGAGAAAGATTAGGCTGCTGG + Intronic
949892972 3:8746775-8746797 AGAGAGAGAGAGTGTGAGGAGGG - Intronic
949925194 3:9035616-9035638 AGAAAGAAAGAAAGAGAGGCAGG + Intronic
950461399 3:13124388-13124410 AGAGATGAAGAAACTGAGGCTGG - Intergenic
950462149 3:13130984-13131006 AGAGAGAAAGAAAAGAAGGAGGG + Intergenic
950839215 3:15950609-15950631 AAAGAGAAAGAAAATTAGCCAGG - Intergenic
950945188 3:16938413-16938435 GGACAGAAAGAAAATGAGGATGG - Intronic
951117696 3:18885025-18885047 AGAGAGAAATAATATGTTGCAGG - Intergenic
951750568 3:26030205-26030227 GGATAGAAAGAATATGAGAGAGG + Intergenic
952215082 3:31270244-31270266 AGAGAGGAAGAAAAGGAGGGAGG + Intergenic
952270805 3:31829625-31829647 GGAGAGAAAGAAAGTGAAGCAGG + Intronic
952473252 3:33678651-33678673 AGAGAGAAGGAAAATGATACAGG + Intronic
952558947 3:34567152-34567174 ACAAAGAAAGAATATTAGCCTGG - Intergenic
952607357 3:35165212-35165234 AGAGAGAGAGAATATTATTCAGG - Intergenic
952652968 3:35748041-35748063 AGAGAGAAAGAAAAGGAAGAAGG + Intronic
952652986 3:35748269-35748291 AGAAAGAAAGAAAAGGAGGAAGG + Intronic
952976513 3:38701023-38701045 AGAGATCAAGAATATTATGCAGG - Intronic
953046861 3:39301317-39301339 GGAGATAAAGAATAGGAGGATGG + Intergenic
953088287 3:39696219-39696241 AAAGAAAAAAAATATTAGGCTGG - Intergenic
953135471 3:40177920-40177942 AGAGAGAAGGAACGTGAGGAAGG - Intronic
953431984 3:42847615-42847637 AGTGAGACAGAGGATGAGGCAGG + Intronic
953577676 3:44126374-44126396 AGAGAAAAAGGAGAGGAGGCAGG - Intergenic
955058122 3:55474116-55474138 AGGGAGAAAGAAAGTGAGACGGG + Intronic
955161734 3:56469960-56469982 AGAGAGAAAGAAGAGGATGAGGG - Intergenic
955784352 3:62521219-62521241 AGAGAAAAAAAATATTAGGTGGG + Intronic
956118735 3:65944607-65944629 AGAGAGAAAGAACAGAAGGAAGG + Intronic
956176679 3:66479388-66479410 AGGGAAAAAGAAAATGTGGCAGG - Intronic
956235487 3:67066149-67066171 TGAAAAAAAGGATATGAGGCTGG + Intergenic
956309171 3:67860208-67860230 AGAGAGAAAGTAAATTAGGGAGG + Intergenic
956377815 3:68634548-68634570 AGAGAGGAACAAGATGAGGCTGG - Intergenic
956544937 3:70390554-70390576 AGAGAGAAAGAGGATGGGGGAGG + Intergenic
956673256 3:71711242-71711264 AGAGAGAAAGAAAAGGTGGCAGG - Intronic
956812572 3:72878420-72878442 AGAGAGAAGGAAAATGATGTAGG - Intergenic
956934382 3:74083231-74083253 AGAGAGAAAGCTTATGAAGTAGG + Intergenic
957163873 3:76645580-76645602 AGAGAGAGAGAATAAGAGAGTGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957354700 3:79066661-79066683 AGAGAGAAAGAATGGTAAGCGGG - Intronic
957516160 3:81254212-81254234 ATAGAATAAAAATATGAGGCTGG + Intergenic
957846760 3:85746531-85746553 AGAGAAAAAGAAAAGGAGGAGGG - Intronic
957979813 3:87494387-87494409 AGAGAGAAAGAAAGGGAGGGAGG + Intergenic
958580334 3:96010333-96010355 AGAGAGAAAGAATGACAGGGAGG + Intergenic
959405234 3:105953415-105953437 ATAGAAAAACAACATGAGGCTGG - Intergenic
959418858 3:106109672-106109694 AGAGAGAAAGAAAAAGAGGAAGG - Intergenic
959962896 3:112320730-112320752 AGAGAAAAAGAAAAAGAGCCAGG + Intergenic
960093334 3:113664391-113664413 ACAGAGCAAGAATATGATCCTGG - Exonic
960183239 3:114607597-114607619 AAAGAGTAAGAGAATGAGGCTGG - Intronic
960186547 3:114647365-114647387 AGAAAGGAAGAATATAAGGAAGG - Intronic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960429574 3:117552299-117552321 AGAGAGAGAGAATAGAAAGCGGG - Intergenic
960502323 3:118453250-118453272 AGAGAGAAAGAGAGTGAGGGAGG - Intergenic
960719098 3:120608008-120608030 AGAGAGAAAGAAATACAGGCCGG - Intergenic
961036677 3:123647318-123647340 AGAGAAAGAGAATATCCGGCAGG - Exonic
961074305 3:123967420-123967442 AGACACCAAGAATCTGAGGCAGG + Intergenic
961309321 3:125984712-125984734 AGACACCAAGAATCTGAGGCAGG - Intergenic
961935322 3:130576720-130576742 AGCAAGGAAGAATGTGAGGCAGG + Intronic
961961201 3:130857304-130857326 AGAGAGAAAGACCATGAGGGTGG - Intronic
962166131 3:133050297-133050319 AGAGAGAAAGAAAGAAAGGCAGG - Intronic
962292214 3:134146341-134146363 TGAGAGAAAGAAAACAAGGCTGG + Intronic
962803771 3:138912585-138912607 AGAGAGAAAGAAGATAGGACAGG - Intergenic
962816022 3:139001180-139001202 GGAGGGAAAGAATGGGAGGCAGG - Intergenic
962817832 3:139018566-139018588 AGAGAGAAAGACTTTAAGACAGG - Intronic
962991169 3:140578607-140578629 AAAGAGAAAAAAAAAGAGGCTGG - Intergenic
963034383 3:141012918-141012940 AGGGAGAAAGGATATTAGGGTGG + Intergenic
963633947 3:147769605-147769627 ATAAAGAAAGAATGTGAGGATGG + Intergenic
963849174 3:150192564-150192586 AGAGAGAAAAAAAATGATACAGG - Intergenic
964156774 3:153595236-153595258 TGACAGAAAGAAAATGAGACTGG + Intergenic
964284124 3:155098969-155098991 AGAGATAAAGTAGGTGAGGCGGG + Intronic
964357491 3:155863923-155863945 GGAGAGTCTGAATATGAGGCAGG + Intergenic
965077314 3:163995449-163995471 AGAGAGAAAGAAAAAGACACAGG - Intergenic
965206940 3:165731787-165731809 AGAGAGGAAGAAAAGGAGGGAGG - Intergenic
965630647 3:170729152-170729174 AAAGAGAAAGAAAATGGGCCTGG - Intronic
965781216 3:172288136-172288158 AGAGAGAAAGTATGTGAGGCAGG + Intronic
965891888 3:173524220-173524242 TGAAAGAAATTATATGAGGCCGG - Intronic
965910288 3:173766383-173766405 TGAGGAAAAGAAGATGAGGCTGG - Intronic
966110167 3:176391327-176391349 AGAGAGCAATCAGATGAGGCAGG - Intergenic
966275544 3:178161547-178161569 AGAGAGAAAGAAAATGATATAGG + Intergenic
966391148 3:179453416-179453438 CTAAAGAAAGAATATGGGGCCGG - Intergenic
966426026 3:179780508-179780530 AGAGAGAAAGAAAGAGAGTCTGG + Intronic
967000911 3:185333755-185333777 AAATAGAAAGAAAAAGAGGCTGG + Intronic
967175344 3:186857957-186857979 AGAGAGAAAGAAAAGGAGGAAGG - Exonic
967516205 3:190372070-190372092 AGTGAGAAAGACTGTGAGACAGG - Intronic
968138311 3:196235388-196235410 GAAGAGAAAAAATATGAGGGAGG - Exonic
968146824 3:196306265-196306287 AGAAAGAAAGAAAATTAGCCAGG + Intronic
968841950 4:3014082-3014104 AGAGTGACAGAATGGGAGGCGGG - Intronic
968991630 4:3917288-3917310 AGAAAGAAAGAAGAGGAGGAAGG + Intergenic
969063929 4:4462148-4462170 AGAAAGAAAGAAATGGAGGCAGG - Intronic
969108854 4:4828818-4828840 GGAGAGAAAGAGAATGAGGAGGG - Intergenic
969202161 4:5615063-5615085 AGAGAAAAAGAATGTGATGGAGG + Intronic
969441332 4:7218555-7218577 AGAGACAAAGAATATGCAGTAGG - Intronic
969669586 4:8582363-8582385 AGAGAGAAAGAACAAGGGGTAGG - Intronic
969803166 4:9585805-9585827 AGAGAATCAGAAAATGAGGCTGG + Intergenic
969826723 4:9763766-9763788 AGAGAGAGAGAATATGCTGCAGG + Intergenic
969936292 4:10685204-10685226 ATACAGCAAGAATAAGAGGCAGG - Intergenic
970153446 4:13116465-13116487 AGAGAGAAAGTAAAGGAGGAAGG + Intergenic
970284563 4:14495716-14495738 AGAGTGGAATAAGATGAGGCTGG + Intergenic
970371954 4:15417065-15417087 ACAGAGAAAGAATAAAAGGTGGG - Intronic
970477768 4:16440964-16440986 AGAGAGAGAGAATCTCAGGCTGG - Intergenic
970627339 4:17902148-17902170 AGAGAGACACAAGATGTGGCTGG + Intronic
970689942 4:18611506-18611528 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
970692347 4:18633852-18633874 GGAGAGAGAGCCTATGAGGCTGG + Intergenic
971004806 4:22361284-22361306 AGAAAGAAAGAAAAAGAGGAAGG + Intronic
971371189 4:26020483-26020505 AAAAAGAAAGAATTTGGGGCGGG - Intergenic
971394298 4:26214374-26214396 AGAGAGAAAGAAGGGGAGGGAGG + Intronic
971705492 4:30037191-30037213 AGAGAGAAAAAAAATGATTCAGG - Intergenic
971971585 4:33627462-33627484 AGAGAGATGGAATATGAAGAGGG - Intergenic
972216915 4:36907640-36907662 AGAGAGAGAGAAGAAGAGACAGG + Intergenic
972382712 4:38534344-38534366 AGACAAAGAGAATATTAGGCAGG + Intergenic
972707380 4:41558494-41558516 TGAGGGACAGGATATGAGGCTGG - Intronic
972740886 4:41885033-41885055 GGAGGGAAAGAAAACGAGGCTGG - Intergenic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
972832313 4:42828541-42828563 AGTGAGAAATAAAATGATGCTGG - Intergenic
973754998 4:54065455-54065477 GGAGAGGAAGAAAAGGAGGCAGG + Intronic
973881573 4:55278123-55278145 AGAGAGAGAGAATTTCAGGGTGG + Intergenic
974171666 4:58274518-58274540 ACAGAAAAATAATCTGAGGCCGG + Intergenic
974269364 4:59630531-59630553 AGAAAGAAAGAATGTGAAGTTGG - Intergenic
974348516 4:60714505-60714527 AGGGATAATGAAAATGAGGCAGG - Intergenic
974428840 4:61770873-61770895 AGAGAGAAAGAACATTAGAAAGG - Intronic
974515470 4:62902551-62902573 AGAGAGAAAGAAGAAGGAGCAGG + Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
974886253 4:67821269-67821291 AGAGAGAAAGAAAATGAGAGAGG + Exonic
975269997 4:72420246-72420268 AGAGAGTGAGCAGATGAGGCCGG - Intronic
975452115 4:74540617-74540639 GGAAAGAAGGGATATGAGGCTGG + Intergenic
975504419 4:75122656-75122678 AGAAAGAAAGAATAAGAAGAAGG + Intergenic
975504434 4:75122770-75122792 AGAAAGAAAGAATAAGAAGAAGG + Intergenic
975665927 4:76735091-76735113 AGAGCAATAGAAAATGAGGCTGG + Intronic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
975782918 4:77858587-77858609 AGAGAGGAAGAAAATAAGACTGG + Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976784821 4:88806344-88806366 AGAGAGAAAGAGAATGCTGCAGG - Intronic
976812196 4:89109937-89109959 AGAGAGGAAGAGTAAGAGGCAGG + Intronic
976864014 4:89702404-89702426 AGAGAGAGAGAATGTGAGCCAGG + Intergenic
977035887 4:91952476-91952498 ACAAAAAAAGGATATGAGGCCGG - Intergenic
977136530 4:93311525-93311547 AGCAAGAAAAAAAATGAGGCAGG + Intronic
977346064 4:95817737-95817759 AGAGAGAAAGTTAATGAGGGTGG - Intergenic
977441268 4:97070742-97070764 AGAGAGAAAGAAATTGAGAGAGG - Intergenic
977582634 4:98742373-98742395 ACAGAAAAAGAATTTTAGGCTGG - Intergenic
977621513 4:99142786-99142808 AGAGAGAAAGAAAAGGAAGAGGG + Intronic
977991738 4:103451401-103451423 ATAAAGAAAGGAAATGAGGCAGG - Intergenic
978081757 4:104601968-104601990 AAAGAGAAAGAAAAGGAGGGAGG - Intergenic
978462120 4:108967655-108967677 AGAGAGATAGATTATCAGGGAGG - Intronic
978555455 4:109974551-109974573 AGAGAGAAAGAGTAAGAGATAGG + Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
978758170 4:112326529-112326551 AGAGAGAAAGAAAGGGAGGCAGG + Intronic
978860595 4:113443962-113443984 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
979083196 4:116369841-116369863 AGAGGGAAAGAGTATGAAGGGGG - Intergenic
979119382 4:116876473-116876495 AGTGAGAAAGAGAATGAGGGGGG - Intergenic
979336033 4:119463957-119463979 TAAGTGAAAGAATATGAGGCTGG + Intergenic
979846461 4:125519083-125519105 GGAGAGAAAGAAAAAGAGGAAGG - Intergenic
980038690 4:127914290-127914312 AGAGAGATAAAATATGGGGAGGG - Intergenic
980673070 4:136035647-136035669 ACAGCCAAAGAATATGAGGGTGG - Intergenic
980746369 4:137022133-137022155 AGAGATAAAGAAAATGAGTCTGG + Intergenic
980910036 4:138985990-138986012 AGAAAAAAAGAATTAGAGGCTGG + Intergenic
981004520 4:139861344-139861366 AGAGAGAAAAATTAAGAAGCAGG - Intronic
981023060 4:140048993-140049015 AGAGAGAAAGAAAAAGAGAGAGG + Intronic
981085634 4:140680601-140680623 AGAGAAAATGAAGATGAGGCGGG - Intronic
981595370 4:146415106-146415128 AGAAAAAAAGAATGTGAGTCAGG + Intronic
981991194 4:150922883-150922905 ACAGAAGAAGAATCTGAGGCAGG + Intronic
982072531 4:151707938-151707960 AGAGAGAAACAATAGGAAGAAGG + Intronic
982395338 4:154909843-154909865 AGTGAGGAAAAAAATGAGGCAGG - Intergenic
982998495 4:162381770-162381792 AGATAAAAAGAAGATGGGGCTGG + Intergenic
983166366 4:164482010-164482032 AGAGAGAAAGAAAGAGAGGAAGG + Intergenic
983307935 4:166017678-166017700 AAAGAGAAAGAACAAGAGGAAGG - Intronic
983626463 4:169806668-169806690 AGAAAGAGAGAATTTGAGGAAGG + Intergenic
983629710 4:169837617-169837639 AAAGAGAAAGAATATGTGTCAGG + Intergenic
983732240 4:171010436-171010458 AGAGAGCAAGAGAATGAGGTGGG - Intergenic
984022069 4:174497870-174497892 AGAGAGAGAGAAAGTGAGGCCGG - Intronic
984214114 4:176887128-176887150 AGAGAGAAAGAAAGGGAGGGAGG - Intergenic
984423530 4:179554652-179554674 AGAGAGAGAGAACAAGAGGGAGG + Intergenic
984423583 4:179555460-179555482 AGAGAGAGAGAACAAGAGGGAGG - Intergenic
984490894 4:180433212-180433234 AGAAAGAAAGAAATTGGGGCTGG - Intergenic
984634932 4:182100881-182100903 AGAGAGAGAGAAAATTAGCCAGG + Intergenic
984850123 4:184145304-184145326 AGGAAGAAAGAAAAGGAGGCAGG - Intronic
984859694 4:184226944-184226966 GGAGAGAAAGGATATTAGGTGGG - Intergenic
984968073 4:185158530-185158552 ATAGTAAAAGAATTTGAGGCCGG - Intergenic
985192912 4:187396516-187396538 AGAGGGAAAGAATAGGAAGAAGG + Intergenic
985222752 4:187725642-187725664 AGAGAGAGGGAAAACGAGGCTGG - Intergenic
985246724 4:187986531-187986553 ACACAGTAAGAATATGATGCTGG + Intergenic
985310815 4:188596440-188596462 AGTAAAAAAGAATAAGAGGCTGG + Intergenic
985320260 4:188702775-188702797 AGAGAGAATAGATGTGAGGCCGG + Intergenic
985356795 4:189128692-189128714 AGAGAGAAAGTAGGTGGGGCAGG + Intergenic
986001169 5:3631889-3631911 AAAGAGAAAGAAAGAGAGGCAGG - Intergenic
986278652 5:6304518-6304540 GGAGAGAAAGAAGAAGAGGAGGG + Intergenic
986662811 5:10074369-10074391 ACAGAGAAGGAATCTGTGGCAGG - Intergenic
987650269 5:20732356-20732378 GGAGAGAAAGAGTATGAAGGGGG + Intergenic
987763566 5:22195880-22195902 AGAGAGAAAGAAAGAGAGGGAGG - Intronic
988179949 5:27777687-27777709 AGAGAGAAAGAATGAGAAGAAGG + Intergenic
988223269 5:28377223-28377245 AAAAAGCAATAATATGAGGCAGG - Intergenic
988224990 5:28402215-28402237 AGAGAGAGAAAAGATGGGGCAGG - Intergenic
988246453 5:28688754-28688776 AGAGAGAAAGAAGAAGAAGGAGG - Intergenic
988294893 5:29343986-29344008 AGAGAGAAAGAATATGCTAGGGG + Intergenic
988407990 5:30849321-30849343 AGAGAAAAGGAACATGCGGCGGG + Intergenic
988440018 5:31223015-31223037 AGAGAGAAAGAGTAAGAGAGAGG - Intronic
988490991 5:31705420-31705442 AAAGAGATAGAATTTGAGGTTGG + Intronic
988579511 5:32456603-32456625 AGAGATGCAGAATATGAGGGAGG - Intergenic
988624264 5:32854248-32854270 AAAGAGGAAGAATGTGATGCAGG + Intergenic
988924608 5:35977109-35977131 AGAGAGAAAGAAAAGAAGGAAGG + Intronic
989003962 5:36789236-36789258 AGAGAGAAAAAAAAGGAGGGAGG - Intergenic
989416622 5:41184928-41184950 ATAAAGGAAGTATATGAGGCTGG - Intronic
990004229 5:50926376-50926398 AGAGAGAGAGAATAGAAGGATGG + Intergenic
990119916 5:52438496-52438518 GGAGAGATAAAATAAGAGGCAGG + Intergenic
990353996 5:54947359-54947381 AGAGAGAGAGAATAAGAGAGAGG - Intergenic
990513631 5:56512349-56512371 AGAGGGAAAGAGAATGAGCCTGG + Intronic
991146117 5:63306606-63306628 AGAGAGAAAGAATAAGGCACTGG + Intergenic
991185267 5:63799441-63799463 AGAGAGAGAGAACATGAAGAGGG - Intergenic
991348589 5:65696251-65696273 AGAGAGAGAGAGCATGATGCAGG - Intronic
991433562 5:66573280-66573302 AGAGAGAAAGAGGAAGAGGACGG + Intergenic
991978546 5:72207935-72207957 AGAGAGAGAGAAAGTGAGGAGGG - Exonic
992491087 5:77245573-77245595 AGAGAAAGAGGAAATGAGGCAGG - Intronic
992795834 5:80254680-80254702 AGAGAGAAAGAGAATGAGAATGG - Intronic
992821242 5:80498694-80498716 CAAGAGAAAGAAGATGAAGCTGG - Intronic
992914588 5:81434910-81434932 GGAGAGAAAGAATCTGGGGCAGG + Intronic
992917701 5:81476065-81476087 AGAGAGAAAGAAAAGGAGAAAGG - Intronic
993247521 5:85469314-85469336 AGAGAGCAAGAAAATGAGACTGG + Intergenic
993248342 5:85481591-85481613 AGAGAAAAATAATATGATGTGGG - Intergenic
993401038 5:87451468-87451490 AGAAAGAAAGAATATGAGGGAGG - Intergenic
993427718 5:87788984-87789006 AGAAAGAAAGAAAAGGAGGGAGG + Intergenic
993721451 5:91325217-91325239 AGACAGAAAGAACCTGAGGAAGG - Intergenic
993727492 5:91384618-91384640 AGAAAGAAAAAATATGAATCTGG + Intergenic
993874237 5:93287507-93287529 AGAGAGAAAGAGAAGGAGGGAGG + Intergenic
993930065 5:93926937-93926959 ACAGAGGAAGAAAATGATGCAGG + Intronic
994010801 5:94899839-94899861 AGAAAGAAAGAACATGAGGCAGG - Intronic
994010949 5:94901467-94901489 AGAGAGAAAGAACATGAGTCAGG - Intronic
994192177 5:96880900-96880922 AGAAAGGTAGAAAATGAGGCTGG + Intronic
994809872 5:104502249-104502271 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
995044656 5:107632148-107632170 AGAGAGAAAGGAAAGGAGACGGG - Intronic
995106119 5:108380625-108380647 AGAGAGAAAGCCTCGGAGGCGGG + Intronic
995372727 5:111437784-111437806 AGAGTGACAGAATATGAGGCTGG + Intronic
995495596 5:112738439-112738461 TGAGAGAAAGAGGAGGAGGCAGG + Intronic
995579507 5:113580788-113580810 AGTGACAAAGAATTTGGGGCAGG - Intronic
995644770 5:114299114-114299136 AGAAAGAAAGAATAAGAGGAAGG - Intergenic
995879362 5:116826731-116826753 AGAGAGAAAGAAAGTGGGGCAGG - Intergenic
995931413 5:117450757-117450779 AGAAAGAAAGAAAATAAGGAAGG - Intergenic
995976101 5:118036551-118036573 AGGGAGGAAGAAAATGAGGGAGG + Intergenic
996736150 5:126760435-126760457 AGAAAGAAAGAAAATCGGGCCGG - Intergenic
996930045 5:128875274-128875296 ATAAAGAAAGAACCTGAGGCTGG - Intronic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
997731921 5:136187754-136187776 GGAGTGAGAGAAGATGAGGCTGG + Intronic
998241373 5:140448200-140448222 AGTGAGAAAGAATAAGAGAGTGG + Intronic
998275155 5:140745516-140745538 AGAGAGAAAAAATATGTTTCAGG - Intergenic
998429675 5:142060157-142060179 AAAGAAAAAGAATTTGAGACAGG - Intergenic
998529280 5:142870192-142870214 AGAGAGAAAAGAGAAGAGGCTGG - Intronic
998585627 5:143423900-143423922 AGAGAGAAAGAATAGAATGATGG + Intronic
998769164 5:145522450-145522472 AGAGAGAGAGAAAATGAGAGAGG + Intronic
999803988 5:155065052-155065074 ACAGAGGAAGAGAATGAGGCTGG + Intergenic
999943459 5:156569676-156569698 AGAGAGCAAGAGTAAGAGGATGG + Intronic
999944867 5:156584151-156584173 AGAGAGAAAGACTATGTGCTTGG - Intronic
999977350 5:156925011-156925033 AGAGAGAGAGAATATAGGCCAGG + Intronic
1000120716 5:158195199-158195221 AGAGAGAAATAATTTGAAGTCGG - Intergenic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1000371503 5:160540902-160540924 AGGAAGAAAGAATATGAAGGAGG + Intergenic
1000772769 5:165377815-165377837 AGTGAGACAGACTATGAGACTGG - Intergenic
1000853290 5:166367354-166367376 AGAGAAAAAGAATATTATTCTGG + Intergenic
1001108368 5:168875122-168875144 AGGGAGAAAGAATGAGAGGGAGG + Intronic
1001115046 5:168932451-168932473 AGACAGAAAGACTAGGAGGTAGG + Intronic
1002112079 5:176923565-176923587 AGAAAGAAAGAAAATAAGGTCGG + Intronic
1002205601 5:177560404-177560426 AGAAAGAAAGAATTTGGGGGGGG - Intergenic
1002305102 5:178278547-178278569 AGTGAGAAAATAGATGAGGCTGG - Intronic
1002482709 5:179513897-179513919 AGAGAGTAAAAAGATGGGGCCGG - Intergenic
1003095321 6:3138312-3138334 TCAGATAAAGAATAGGAGGCTGG - Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003422545 6:5971389-5971411 AAAGAAACAGAATAGGAGGCAGG - Intergenic
1003490793 6:6619858-6619880 AGAGGGAAAGAATGAGAGACAGG + Intronic
1003516580 6:6823564-6823586 AGAGAGAAAGAAGAAGAAGAAGG + Intergenic
1003611086 6:7615501-7615523 AAAAAAAAAAAATATGAGGCCGG + Intergenic
1003788439 6:9514579-9514601 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1003861945 6:10330419-10330441 AGAAAGAAAGGATTTAAGGCCGG - Intergenic
1004469932 6:15920248-15920270 GGAGAGAAAGAACAGGAGACAGG + Intergenic
1004564162 6:16780046-16780068 AGAAAGAAAGAAAATTAGCCAGG - Intergenic
1004769759 6:18768750-18768772 AGAAAGAAAGAAAAAAAGGCTGG + Intergenic
1005162704 6:22883210-22883232 AGAGGTAAAGAATAGGAGGAAGG - Intergenic
1005221274 6:23591674-23591696 AGGGAGAAAAAAAATGACGCTGG + Intergenic
1005372870 6:25153433-25153455 AGAGAGAAAGACCATGATACAGG - Intergenic
1005440187 6:25859232-25859254 AGAGACAAATAATATTAGTCAGG + Intronic
1005818247 6:29574990-29575012 ACAGAGAAAGACTAAGAGTCAGG + Intronic
1006081184 6:31567812-31567834 AGAGAGAGAGACTGGGAGGCGGG - Intergenic
1006432642 6:34007403-34007425 AGAAAAAAGGAAGATGAGGCTGG + Intergenic
1006508854 6:34510681-34510703 AGAGACAGAGAGTATGAGGCAGG - Intronic
1006712867 6:36090502-36090524 AGAGAGGGAGAATATTTGGCAGG - Intronic
1006827833 6:36949080-36949102 AGAGAAAAAGAAAATAAGGCTGG - Intronic
1007322017 6:41034254-41034276 AGAGAGAAAGGAGGTGGGGCAGG + Intronic
1007413775 6:41680221-41680243 AAAGAAAAAAAAGATGAGGCTGG + Intergenic
1007424229 6:41736320-41736342 AGAGAGGAAGAAAAGGAGGAGGG - Intergenic
1007594304 6:43042060-43042082 AGAGAGAAAGAGAAGGAGGGAGG + Intronic
1008087820 6:47262816-47262838 AGAGAGAAAAAATTGGAGTCAGG + Intronic
1008118270 6:47578951-47578973 AGAGAAAGATAAAATGAGGCCGG - Intronic
1008391899 6:50961939-50961961 AGAGAGAAAGAAGAGGAGTGGGG - Intergenic
1008990556 6:57596674-57596696 AGAGAGACAGAATAAGAGATAGG - Intronic
1009338660 6:62526404-62526426 AGAGAAAAAGAAAAAGAGACAGG - Intergenic
1009395126 6:63190806-63190828 AGAGAGAAAGAAAGTGAAGAAGG - Intergenic
1009575210 6:65447283-65447305 AGAGAGAAAGAAAGAGAGTCAGG - Intronic
1009973239 6:70646689-70646711 AGAGAGAAAGAAGATGACTAGGG + Intergenic
1010262295 6:73830901-73830923 AGAGAGAGAGAATAGGGGGGAGG - Intergenic
1010320402 6:74502078-74502100 AGACAGCAAGAATTTGAGGTAGG - Intergenic
1010554204 6:77258814-77258836 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic
1010653306 6:78480151-78480173 AGAGAGAAATAATCTGAAGATGG - Intergenic
1011118468 6:83923000-83923022 AGAGAGAAAAAAAATAAGGGGGG - Intronic
1011707258 6:90013802-90013824 AGAAAGATAGAAAAAGAGGCCGG - Intronic
1011754985 6:90489280-90489302 AGATATAAAGAAAATGGGGCCGG - Intergenic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1011944751 6:92887343-92887365 AGAAAGAAAGAATATGTGAAAGG - Intergenic
1012422285 6:99078487-99078509 AGGGAGAAAGAATGGGAGGGAGG + Intergenic
1012651757 6:101762525-101762547 AGAAAGAAAGAAATTGGGGCTGG - Intronic
1013467485 6:110430340-110430362 AGGGAGAATGTACATGAGGCTGG + Intronic
1013498901 6:110727824-110727846 AGAAAGAAAGAAAATTAGCCAGG + Intronic
1013766302 6:113578047-113578069 AGAGAGAGAGAAAAGGAGGGAGG - Intergenic
1014078669 6:117265258-117265280 AGAGAGAGAGAGAAGGAGGCGGG - Intergenic
1014927485 6:127290870-127290892 AGAGAAAAAGAAAATGAGGCAGG + Intronic
1015189885 6:130461034-130461056 AGAGAGAAAGAAAGGGAGGGAGG - Intergenic
1015529287 6:134204944-134204966 AGAAAGAAAGAAAAGGAGGGAGG - Intronic
1015972165 6:138753078-138753100 ACATACAAAGAATTTGAGGCAGG - Intronic
1016026847 6:139296145-139296167 AAAGAGGAAGAATAGGAGCCAGG - Intergenic
1016058367 6:139602673-139602695 TGAGATAAGGAATAGGAGGCAGG - Intergenic
1016118231 6:140314591-140314613 AGAGAGAAAGAAATTGAGAGAGG + Intergenic
1016248213 6:142013252-142013274 AGAGAGAGAGAAAAAGAGGGAGG - Intergenic
1016351743 6:143176447-143176469 GTAGAGAAAGACTATCAGGCTGG + Intronic
1016469654 6:144361747-144361769 AGAAAGAAAGAAAATTAGCCAGG - Intronic
1016534218 6:145092644-145092666 AGAGAGGAAGAAAAGGAGGAAGG - Intergenic
1016620335 6:146102127-146102149 AAAGAGTAAGAAAAAGAGGCAGG - Intronic
1016641609 6:146355790-146355812 AGAGAGAAAGAATTGCAGGAAGG + Intronic
1016726523 6:147376386-147376408 AGAGAGAGAGAATACAAAGCAGG + Intronic
1016819598 6:148334999-148335021 AGAAAAAAAGAATTTGAGGCCGG + Intronic
1016821489 6:148350138-148350160 AGAGAGAAAGAAAATCTGCCGGG - Intronic
1016864444 6:148751151-148751173 AGAAAGGAGGAATGTGAGGCGGG + Intronic
1017016730 6:150107075-150107097 AGAGAGAAAAGAGAGGAGGCAGG - Intergenic
1017175154 6:151495483-151495505 AGAAAGAAAGAAAAGGAGGGAGG - Intronic
1017297216 6:152811983-152812005 AAAGAGAAAGAAGAGGAGGAAGG - Intergenic
1017424996 6:154311260-154311282 AGAGAAAAAGAGTATTAGGATGG - Intronic
1017562767 6:155647831-155647853 AGAGAGAGAGAAGAGGAGGTGGG - Intergenic
1017961177 6:159222028-159222050 AGAGAGAAGGAAGAGCAGGCGGG + Intronic
1017971778 6:159318077-159318099 AAAAAGAAAGAATGAGAGGCTGG - Intergenic
1018430833 6:163721144-163721166 AGAGAGAAAGCATAGGATGGTGG - Intergenic
1018692967 6:166363883-166363905 AAAGTGACAGAATATGAAGCCGG + Intergenic
1019099303 6:169615178-169615200 AAAGAGAGATAATATTAGGCTGG + Intronic
1019227808 6:170529610-170529632 AGAGAGAAAGAAGAAGAAGGAGG - Intergenic
1019560992 7:1657174-1657196 ACAGAGAAACAAGATGAAGCGGG + Intergenic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019780018 7:2934192-2934214 AGAGAGAAAGAAAGACAGGCTGG - Intronic
1019830325 7:3321824-3321846 AGAGAGAGAGAAAAGGAGGAAGG - Intronic
1019981979 7:4628391-4628413 ACAGATAAAGAAACTGAGGCCGG - Intergenic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020222179 7:6247960-6247982 AGAGAGTTATAAAATGAGGCTGG - Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020380667 7:7542051-7542073 ATAAAGAAAGAAGATGGGGCTGG + Intergenic
1020785479 7:12568213-12568235 AGAGATGAGGAACATGAGGCTGG + Intergenic
1020953693 7:14712424-14712446 AGAAATAGAGAAAATGAGGCGGG + Intronic
1022097480 7:27150146-27150168 AGAGAGAGAGAATATCTGGTTGG - Intronic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022909804 7:34889871-34889893 ATAGAGAAAGACAATGAGACTGG + Intergenic
1023056268 7:36292452-36292474 AGAGAGAAAGACAAGGAGGGAGG - Intronic
1023259484 7:38344471-38344493 AGAGAGAGAGAATAAAAGGGAGG + Intergenic
1023259942 7:38348796-38348818 AGAGAGAGAGAATAAAAGGGAGG + Intergenic
1023260417 7:38353154-38353176 AGAGAGAGAGAATAAAAGGGAGG + Intergenic
1023260925 7:38357953-38357975 AGAGAGAGAGAATAAAAGGGAGG + Intergenic
1023261384 7:38362303-38362325 AGAGAGAGAGAATAAAAGGGAGG + Intergenic
1023293008 7:38686920-38686942 GAACAGAAAGAAAATGAGGCTGG + Exonic
1023528414 7:41129271-41129293 AGAGAGAAAGAGAAAGAGGTTGG - Intergenic
1024004559 7:45215995-45216017 AGAGAGAAAGAAGGGGAGGGAGG + Intergenic
1024067769 7:45755912-45755934 TAAGTGAAAGAATATGAGGCTGG - Intergenic
1024164436 7:46715986-46716008 AGAGAGAAAAAATGAAAGGCAGG - Intronic
1024441688 7:49426864-49426886 AGAGAGAAATAACATAATGCTGG + Intergenic
1024694505 7:51840945-51840967 AGAGAGGGACAAGATGAGGCAGG + Intergenic
1024823333 7:53360118-53360140 AAAGAGAAATAATCTGAGGAGGG - Intergenic
1024906812 7:54392478-54392500 AGGGAGAATTATTATGAGGCTGG + Intergenic
1025185166 7:56851982-56852004 AAAGAGAGAGACTATAAGGCAGG + Intergenic
1025686765 7:63724977-63724999 AAAGAGAGAGACTATAAGGCAGG - Intergenic
1025719575 7:63997969-63997991 AAAGAGAAAGAACTTGGGGCTGG + Intergenic
1026192236 7:68140086-68140108 AGAGAGAAAGCAAAAGAGGGAGG + Intergenic
1026210467 7:68299489-68299511 AAAGAGAAAGAATAAGAGCAAGG - Intergenic
1026415314 7:70173379-70173401 AGAGAGAAAGAAAATGTTGACGG + Intronic
1026656220 7:72258918-72258940 AGAAAGAAAGAAAATTAGCCAGG + Intronic
1026797300 7:73374605-73374627 AGAAAGAAAGAAAATTAGCCAGG + Intergenic
1026817912 7:73526519-73526541 AGAAAGAAAGAAAAAGAGCCAGG - Intergenic
1026946536 7:74319829-74319851 AGAGAGAAAGAAGAAAAGTCTGG + Intronic
1026961492 7:74410931-74410953 AGAGAAAAGGAAAATGAGGGAGG + Intergenic
1027334119 7:77130576-77130598 AGAAAGAAAGGATATTATGCTGG - Intronic
1027472618 7:78592031-78592053 AGAGAAAAGAAATATGAGGGAGG + Intronic
1027501342 7:78955630-78955652 AGAGAGAGAGAAAAGGAGGGAGG - Intronic
1027539671 7:79452642-79452664 AGAAAGAAAGAATGGGAGGAAGG - Intronic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027679471 7:81202138-81202160 ACAGAGAAGGAAAATGAGACAGG + Intergenic
1027713991 7:81645955-81645977 ACAGAGAAAAAATATGATGCTGG + Intergenic
1027923568 7:84429833-84429855 TGGGAGGAAGAAAATGAGGCAGG + Intronic
1028246661 7:88487321-88487343 AGAGAGAGAGAAAAGAAGGCGGG + Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028704890 7:93830374-93830396 CCAGAGAAAGAATAAGAGACAGG + Intronic
1029469212 7:100743315-100743337 AGAAAGAAAGAATATCAGCCAGG - Intronic
1029473943 7:100771813-100771835 AGAGAGAAGGCAGATGAGCCAGG - Intronic
1029546620 7:101213481-101213503 GGAGAGAGAGAATATGAGGAGGG - Intronic
1029550479 7:101234725-101234747 AGAGAGCAAGAAGGTGAGGGGGG - Intronic
1029871113 7:103693591-103693613 AAAAAGAAAGAAAATTAGGCTGG + Intronic
1030034465 7:105396831-105396853 AGAGAGAAAGAAATAGAGGGAGG + Intronic
1030177110 7:106665948-106665970 GAGGAGAAAAAATATGAGGCTGG + Intergenic
1030206502 7:106957141-106957163 AGAGAGAGAGAGGATGAGGAAGG + Intergenic
1030244964 7:107373617-107373639 AGAGAGGCAGAAGATGAGGGAGG + Intronic
1030409500 7:109157665-109157687 GGTGAGAATCAATATGAGGCAGG + Intergenic
1030880510 7:114872430-114872452 AGAGAAAAAGAACATAAAGCAGG - Intergenic
1031008967 7:116503872-116503894 AGAGAGAAAGAAAGAGAGGGAGG + Intronic
1031307262 7:120145804-120145826 AGAGAGATGGAAAATGTGGCAGG - Intergenic
1031318484 7:120289112-120289134 AAAGAGAAAGAAAGTGAGGGGGG + Intronic
1031713086 7:125073667-125073689 ATAGATAAAGAAAATGAGGTTGG + Intergenic
1032146926 7:129392221-129392243 AGAGTGAAAGAGTATTAGGTTGG - Intronic
1032252953 7:130273348-130273370 AGAGAGAAAGAAAAAGAAGGGGG - Intronic
1032275833 7:130454445-130454467 AGAGAGAAGGAAGATGGGGTTGG + Intergenic
1032451036 7:132031263-132031285 AAACAGCAAGAATAAGAGGCAGG - Intergenic
1032661358 7:133987400-133987422 AGAGAGAAAGAAAAGAAGGAAGG + Intronic
1032685751 7:134231822-134231844 AGAGAGAAAGTAAAGAAGGCAGG - Intronic
1032729139 7:134620481-134620503 ACAGAGAAAGTATATGAGAAAGG - Intergenic
1032746949 7:134795612-134795634 AGAAAGAAAGAAAAGGAGGAGGG - Intronic
1033832036 7:145266692-145266714 AGAGAGAAAAATTAAGAGTCTGG + Intergenic
1034093427 7:148384706-148384728 AAAGAGGAAGAAGATGAGGCAGG + Intronic
1034296411 7:149976590-149976612 AGAGAGAGAGAAAATGATGCAGG + Intergenic
1034346495 7:150388505-150388527 AGAGAGAAGAAAGAGGAGGCAGG + Intronic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1035670943 8:1416806-1416828 GGAGAGACAGAAAAGGAGGCCGG - Intergenic
1035699594 8:1627901-1627923 AGTCAGAAAGAATGTGAGGTCGG - Intronic
1035810546 8:2487476-2487498 AAAGAAAAAGAAAAAGAGGCCGG + Intergenic
1035979308 8:4351618-4351640 AGTGAGAAAGGAGATGAGGGAGG + Intronic
1036156418 8:6346414-6346436 AAAAAGAAAGAAAATGAGGGCGG + Intergenic
1036482074 8:9148856-9148878 AGAGAGAGAGAATAAGAGAATGG - Intronic
1036525188 8:9528489-9528511 AGAGGGAAAGAAAAGGAGGGAGG - Intergenic
1036546559 8:9776065-9776087 AGAGAAAGAGAATATGAAGGAGG + Intronic
1036589707 8:10157771-10157793 AGAGAGAAAGAAGAAGAGGGCGG - Intronic
1036677394 8:10846335-10846357 ACAGAGAAGGAATCTCAGGCCGG - Intergenic
1037054631 8:14423809-14423831 AGAGAGAAAGTAAATGAGAGAGG - Intronic
1037378587 8:18260368-18260390 AGAGAAAAAAGATATGAGACAGG - Intergenic
1037512680 8:19599574-19599596 AGAGAGAAAGGAAAGGAGGAAGG + Intronic
1037514435 8:19616673-19616695 AGAGAGAGAGAGAATGAGGGGGG - Intronic
1037645669 8:20790623-20790645 AGGGAGAAATAATATGAAGGAGG - Intergenic
1037666248 8:20972657-20972679 AGAGAGTGAGAATATGAGTCAGG + Intergenic
1037733589 8:21549498-21549520 AGAGAGAAAGAAAGAGAGGAGGG + Intergenic
1037806867 8:22062809-22062831 TGAGAGAAAGAATGGGAGGGAGG - Intronic
1038056755 8:23865871-23865893 AGAGAACAAGGATATAAGGCTGG + Intergenic
1038291928 8:26257510-26257532 AGAGAGAGAGAAAATTAGCCGGG - Intergenic
1038347574 8:26746515-26746537 GGAGAGAAGAAATATGATGCTGG + Intergenic
1038718404 8:30012057-30012079 AGAGAGAAAGAAAAGGAGAGGGG + Intergenic
1039098393 8:33912663-33912685 AGACAGAAACTCTATGAGGCAGG - Intergenic
1039176566 8:34814392-34814414 AGAGACAAAGAAAATGACTCAGG + Intergenic
1039184660 8:34903734-34903756 ACAGAGAAACAATGTGAGGGTGG - Intergenic
1039198019 8:35053996-35054018 AGAGAGAAAGAAAGAGAGACAGG - Intergenic
1039412690 8:37368531-37368553 AGAGAGGAAGAATGAGAGGGAGG + Intergenic
1039486986 8:37917879-37917901 AGAAAGAAACAAAATCAGGCTGG - Intergenic
1039821600 8:41140094-41140116 AGAAAGAAAGAAAACTAGGCAGG - Intergenic
1039848773 8:41344577-41344599 AGAGAGGAAGAAAGTGAGGCAGG - Intergenic
1039900038 8:41745152-41745174 AGGGAGAAAGAAGAAGGGGCGGG + Intronic
1039963796 8:42269639-42269661 AGAGAGAAAGAAAAAGAGAAAGG + Intergenic
1040903575 8:52441762-52441784 AGAGAGAAAGAAAAGAAGGAAGG + Intronic
1041333802 8:56757421-56757443 AGAGGGGAAATATATGAGGCAGG + Intergenic
1041775167 8:61515060-61515082 AGAGAGAAAAAATAGGAGGTAGG + Intronic
1041870942 8:62633808-62633830 AGGGGGAAAGAATATGAAGAAGG + Intronic
1042230659 8:66551130-66551152 AGAGAGAAAAAAAATTAGCCAGG + Intergenic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042418128 8:68550597-68550619 AGAGAGATAGAAAATGATGTAGG - Intronic
1042597635 8:70466503-70466525 AGAGATAAAAAATATAAGGCCGG - Intergenic
1043139708 8:76572951-76572973 AGAAAGAAAAACTATGAGCCAGG - Intergenic
1043267690 8:78286981-78287003 AGAGAGAAAGAAAAAGAGAGAGG + Intergenic
1043726227 8:83614295-83614317 AGAAAGAAAGAAAAAGAGGAAGG - Intergenic
1043726233 8:83614378-83614400 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
1043726237 8:83614476-83614498 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
1043820007 8:84851701-84851723 ACAGAGAAAGGACCTGAGGCAGG - Intronic
1044477094 8:92639848-92639870 AGTGAGAAAGAAGACGAGGGAGG + Intergenic
1044822978 8:96170148-96170170 TGGGAGAAAGAAGAGGAGGCGGG - Intergenic
1044912040 8:97070158-97070180 AGAGAGAAAGAATAGGAATATGG - Intronic
1045015041 8:97994166-97994188 AGAGGGAAAGAAGAGGAGGAGGG + Intronic
1045029208 8:98118719-98118741 GGAAAGAAAAAAAATGAGGCCGG - Intronic
1045272742 8:100675842-100675864 AGACAGAAAGTAGATGAGCCAGG + Intergenic
1045319683 8:101072621-101072643 AGAGAGAGAGAACAAGAGGCAGG + Intergenic
1045333850 8:101180653-101180675 AGAGAGAAAGAAGGAGGGGCTGG - Intronic
1045371904 8:101532838-101532860 AGAGAGAAAGAGAAAGAGGTGGG + Intronic
1045558096 8:103234398-103234420 AGAAAGAAAGAAAATTAGCCAGG + Intergenic
1046332272 8:112734225-112734247 AAAGAGAAAGAAGAGGAGGAAGG + Intronic
1046368934 8:113274846-113274868 AGAGAGAAAGAAAAAAAGGAAGG + Intronic
1046578439 8:116061875-116061897 ATAAAGAAAGAATATTAGACTGG + Intergenic
1046588475 8:116176542-116176564 AGAGAGAAAGGAAAGGAGGGAGG + Intergenic
1046744199 8:117859848-117859870 ACATAGAATGAAAATGAGGCTGG + Intronic
1047126059 8:121961900-121961922 AGAGAGAGAGAAAAAGAGGGCGG - Intergenic
1047132612 8:122037862-122037884 AAATAGAAATAATATGAGTCTGG - Intergenic
1047221432 8:122921657-122921679 AGAGAGAGAGAAAGTGAGGAAGG + Intronic
1047280231 8:123439171-123439193 AGAAAGAAAGAAAATTGGGCTGG - Intronic
1047306136 8:123654534-123654556 AGAGAGAAAGAAGATGAAGGAGG + Intergenic
1047540897 8:125765366-125765388 AGAGTGGATGAATATAAGGCTGG - Intergenic
1047791842 8:128211235-128211257 AGGGAGAAACTATATGAAGCTGG + Intergenic
1047814073 8:128443581-128443603 AGAGAGAATGAATAAGAGAGTGG - Intergenic
1047919786 8:129622982-129623004 AAGGAGAAAGAACATGAGACTGG + Intergenic
1047953678 8:129956835-129956857 AGAAAGAAAGAAAGAGAGGCTGG - Intronic
1048014190 8:130483079-130483101 AGAGTGAAAGAAGATGAGATTGG + Intergenic
1048398032 8:134033513-134033535 AGAGAGAATAAATGTGAGGTAGG + Intergenic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048696284 8:137031697-137031719 AGAGAGAGAGAATGGGAGGGAGG - Intergenic
1048995607 8:139792061-139792083 AGAAAAAAAGAATAGGCGGCAGG - Intronic
1049191936 8:141293156-141293178 AGTGAAAAAGAAAATGCGGCCGG + Intronic
1049493866 8:142919715-142919737 AGAGAGAAAGAAAATGATACAGG - Intergenic
1049627461 8:143631940-143631962 AGAAAAAAAGAAAATGAGGTAGG - Intergenic
1050396479 9:5203419-5203441 AAAGAGAAAGAAATAGAGGCAGG - Intergenic
1050632127 9:7571274-7571296 AGAGAGAAAGAGAATGATGATGG + Intergenic
1050743246 9:8846748-8846770 AGAGAAAATGAATATGAGTATGG + Intronic
1050775052 9:9249183-9249205 AGAGAGAAAGGAGAAGATGCTGG - Intronic
1050831351 9:10018156-10018178 AAAGAGGAAGAATGTGAGGGAGG + Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1050983626 9:12053795-12053817 AGAGAGAAAGAAAAAGAATCTGG - Intergenic
1051345998 9:16151861-16151883 TGAGAGAGATAATATGAGGGAGG + Intergenic
1051685227 9:19651559-19651581 AGAGAGAAAGAAATTGATGATGG - Intronic
1051885167 9:21884994-21885016 ATAGAGAAAGAATATATGGTGGG + Intronic
1052079901 9:24191907-24191929 AGAGAGAAAGAAAATGATATAGG - Intergenic
1052136720 9:24920992-24921014 AAAGAGAAAGAATAAAAGGTAGG - Intergenic
1052334580 9:27306602-27306624 AGGGAGATAGAATATGAGGCTGG - Intergenic
1052354416 9:27489526-27489548 AGAGAGAAAGGCTATGTTGCTGG + Intronic
1052399378 9:27981189-27981211 AGAGAGAGAGAAACAGAGGCAGG - Intronic
1052433304 9:28394480-28394502 AGAAAGCAAGAAAATGAGGGAGG - Intronic
1053010164 9:34628338-34628360 AGAGAGAAAGAAAAGGAGAAGGG + Intergenic
1053236620 9:36460914-36460936 AGAAAGAAAAAAAAGGAGGCTGG + Intronic
1053398444 9:37797033-37797055 AAATAAAGAGAATATGAGGCTGG + Intronic
1054914707 9:70485328-70485350 AGAGAGAAAGAGTAATGGGCAGG + Intergenic
1055111134 9:72560778-72560800 ACAGATAGAGAAAATGAGGCCGG - Intronic
1055228767 9:74034530-74034552 TTACAGAAAGAATATGAGGTAGG + Intergenic
1055985159 9:82051349-82051371 AGAGAGAATGAAAAAGAGGAGGG - Intergenic
1056197330 9:84240940-84240962 AGAGAGAAGGAAAGTGAGGTTGG + Intergenic
1056513471 9:87328180-87328202 AGAGGGAAGGGAAATGAGGCAGG + Intergenic
1056811626 9:89769475-89769497 AAAAAAAAAGAATAGGAGGCCGG - Intergenic
1057136213 9:92689897-92689919 AGAGAGAAGGAAAATGATACAGG - Intergenic
1057183290 9:93041124-93041146 AGAGAGAAAGAGCTAGAGGCTGG + Intergenic
1057243671 9:93435448-93435470 AGAGAGAGAGAAAAGGAGGTGGG - Intergenic
1057374095 9:94503010-94503032 ACAGAGAAAGAATATGAGAGAGG + Intergenic
1057742013 9:97720187-97720209 AGAAAGAAAGAAAAGAAGGCCGG + Intergenic
1057913516 9:99038032-99038054 AGAGAGAAATAACATCATGCTGG + Intronic
1057947631 9:99343625-99343647 CAAGAGTCAGAATATGAGGCCGG + Intergenic
1057990565 9:99765235-99765257 ACAGAAAAAGACTATGAGGAAGG - Intergenic
1058627913 9:106954299-106954321 AGAGAGAAAGAGAGTGAGGGGGG + Intronic
1058851407 9:109014591-109014613 AGTAAAAAAGAATCTGAGGCTGG + Intergenic
1059033672 9:110730026-110730048 AGAGAGAGAGAATATAATGTGGG + Intronic
1059099604 9:111457365-111457387 AGAGAGAAAGAAACTGAAGAGGG + Intronic
1059137780 9:111823495-111823517 AGAAAGACAGAAAAAGAGGCTGG + Intergenic
1059152075 9:111957971-111957993 AGAAAGAAAGAAAATGATGTAGG + Intergenic
1059352918 9:113678269-113678291 AGAAAGAAAGAAAAGGAGGGAGG - Intergenic
1059605704 9:115832820-115832842 AAAGAGAAAGAGAATGAAGCGGG - Intergenic
1059803471 9:117773799-117773821 AGAGAGAAAGAAAAGAAGGAAGG - Intergenic
1060023192 9:120149833-120149855 AAAGAGACAGAATCTGAGTCTGG - Intergenic
1060074849 9:120581894-120581916 AGAGAGAATGAATATGAATCTGG - Intergenic
1060707311 9:125815963-125815985 AGAGAGAAAGAGTAGGGGGTGGG - Intronic
1060982078 9:127798831-127798853 AGAGAGAAGGATTAGGATGCTGG + Intronic
1060987854 9:127830043-127830065 AGAGAGAAAAAAAATTAGGCTGG + Intronic
1061867706 9:133502583-133502605 AGAGAGATAGAATAGGAGTAGGG + Intergenic
1061943973 9:133898168-133898190 ACAGAGAAGGAAACTGAGGCCGG + Intronic
1061984706 9:134123686-134123708 AGAAAGAAAGAAAATTAGCCAGG + Intergenic
1185545450 X:940410-940432 AGAGAGAAAGAAGAAGAGAGGGG - Intergenic
1185545719 X:942295-942317 AGAGAGAAAGAAGAAGAGGGGGG + Intergenic
1185563571 X:1079249-1079271 GTAGAGTAAGAAAATGAGGCTGG - Intergenic
1185649062 X:1635564-1635586 AGAAAGAAAGAACATGGGCCGGG + Intronic
1185686376 X:1932228-1932250 AGAAAGAAAGAAGATGTGGCCGG - Intergenic
1185755769 X:2651917-2651939 AGAGAGAAAGAAGATGAGGGAGG - Intergenic
1185859448 X:3564167-3564189 AGAGTGAAAGAAAAAGAGACGGG + Intergenic
1185868842 X:3646383-3646405 GGAGAGACAGAAAGTGAGGCTGG - Intronic
1185943219 X:4344631-4344653 AGAGAGAAAGAATGAGAGAGAGG - Intergenic
1185954812 X:4478025-4478047 AGAGAGAGAGAGAATGAGGGAGG + Intergenic
1186006964 X:5083041-5083063 ATATATAAAGAATATAAGGCTGG - Intergenic
1186039915 X:5464380-5464402 ACAGAGAAAAAATATGAGAAAGG + Intergenic
1186095014 X:6091139-6091161 AGAGAGAAAGGAAAACAGGCTGG + Intronic
1186150976 X:6674488-6674510 ATATAGAAAGAATATTTGGCTGG - Intergenic
1186595124 X:10972874-10972896 AGAGGGAGAGAATTTGAGGTTGG - Intergenic
1186951316 X:14628735-14628757 AGAAAGAAAGACTGTGTGGCTGG + Intronic
1186973719 X:14876865-14876887 AGAGAGAAATAACATCTGGCTGG + Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187379992 X:18793029-18793051 AATGATAAAGATTATGAGGCAGG - Intronic
1187480923 X:19654780-19654802 AGAGAGAAAGATGATATGGCTGG + Intronic
1187877428 X:23815836-23815858 AGAGAGAGAGAATATGAAACCGG + Intergenic
1187956210 X:24521536-24521558 AGAGAGAAAGAATATTAAGATGG - Intronic
1188159932 X:26786705-26786727 AAAGAGAAAGATTGTGAGGTAGG + Intergenic
1188400712 X:29740526-29740548 AGAGAGAAAGAAAATGCCGTAGG - Intronic
1188453868 X:30339264-30339286 AGAGAGGAAGAATATGATATAGG - Intergenic
1188455440 X:30359260-30359282 AGAGAGAGAGAAATTGAGGGAGG + Intergenic
1188466679 X:30489245-30489267 AGAGAGAATGGATATGAGCAGGG + Intergenic
1188547168 X:31320938-31320960 AGAGAGAGAGAACAATAGGCAGG - Intronic
1189047084 X:37604888-37604910 AGAGGGAAAGACTTTGTGGCAGG + Intronic
1189468116 X:41293275-41293297 ACAGATGAAGAAAATGAGGCAGG - Intergenic
1189632285 X:42967709-42967731 ACAGAGAAACACTATGAGACTGG + Intergenic
1189709712 X:43796591-43796613 AGAAAGAAAGAAGAGGAGGAGGG + Intronic
1189736826 X:44080029-44080051 AGAGACAAGGAGTATGAGACAGG + Intergenic
1190340374 X:49291277-49291299 AGAGAGAGAGAAAAGTAGGCTGG - Intronic
1190726900 X:53195733-53195755 TGAGAGGAAGAGTGTGAGGCTGG - Intronic
1190739962 X:53282118-53282140 AGTGAGAAAGAATATTGGCCGGG - Intronic
1191014571 X:55794719-55794741 AGAGGAAAATGATATGAGGCAGG - Intergenic
1191136669 X:57070965-57070987 AGATGGAAAGCAGATGAGGCAGG - Intergenic
1192024735 X:67437431-67437453 AGAGAGAGAGAACAGGAGGGAGG - Intergenic
1192089367 X:68136952-68136974 AGACTGATACAATATGAGGCAGG + Intronic
1192124627 X:68490619-68490641 AGATGGAAAGAATACAAGGCAGG - Intergenic
1192356170 X:70406223-70406245 AGAGACAAAGTATATAATGCAGG - Intronic
1192461827 X:71323622-71323644 AGAGAGAGAGAATTCCAGGCAGG - Intergenic
1192547700 X:72027511-72027533 TGAGAGAAAGGAAAGGAGGCAGG - Intergenic
1192745368 X:73933224-73933246 AGAAAGTAAGAATAGTAGGCTGG + Intergenic
1192837869 X:74821202-74821224 AGAGAGAAAGAAGATAATGTTGG - Intronic
1193116365 X:77779236-77779258 AGAGAGATAGCATTTGAGCCGGG - Intronic
1193596316 X:83450865-83450887 AGAGAAAAAGAATCTCAGCCTGG - Intergenic
1194445556 X:93983173-93983195 GTAGAGAAAGATTATGAGGTGGG - Intergenic
1195215991 X:102703120-102703142 AGAGAGAATGAAAATTATGCAGG + Intergenic
1195342015 X:103915756-103915778 AGAGAAAAAGCATACAAGGCCGG + Intergenic
1195612976 X:106890204-106890226 AGAGTGAAATAATATGTAGCCGG + Intronic
1195767462 X:108311492-108311514 AGAGAGAAAGGAGATGAGGTTGG - Intronic
1195968183 X:110448289-110448311 CGAGGGAAAGAAACTGAGGCTGG - Intronic
1196313026 X:114190506-114190528 AGAGAGAAAGAAAATGATGTAGG + Intergenic
1196906659 X:120443733-120443755 AAAGAGAAACATTGTGAGGCAGG + Intronic
1196910640 X:120481374-120481396 AGAAAGAAAGAAAAAAAGGCCGG + Intergenic
1197071730 X:122306806-122306828 AGAGAGAAAGAAAATGATATAGG - Intergenic
1197217810 X:123882937-123882959 AGAAAGAAAGAAAATTAGCCAGG - Intronic
1197330459 X:125147736-125147758 AGAGAAAAATAAAATGAAGCAGG - Intergenic
1197503994 X:127278980-127279002 AGAAAGAAAGAACTTCAGGCTGG + Intergenic
1197665555 X:129219640-129219662 AGAGAGAGAGAATATGAGAGAGG - Intergenic
1197700232 X:129594219-129594241 AGAGAGAAAGAAGACTAGGCAGG - Intergenic
1197728788 X:129793603-129793625 AGGGAGACAGAATATGGGGGTGG - Intronic
1197818740 X:130524729-130524751 AGAGAGAAAGAGGAAGAGGAGGG - Intergenic
1197825549 X:130586626-130586648 AGAGAGAAATAATGTGATGAAGG + Intergenic
1198300863 X:135333115-135333137 AGAGAGAAAGAAAATTTGGCTGG + Intronic
1198380332 X:136077712-136077734 AGAGAGGAAGAATATGAGTAGGG - Intergenic
1198392837 X:136193720-136193742 AGACTGAAAGAATGAGAGGCAGG - Intronic
1198518791 X:137432173-137432195 AGAGAGAGAGAATATGAGAAAGG + Intergenic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1199059713 X:143340553-143340575 AAAGAGAAAGAAGAGGAGGAGGG + Intergenic
1199770515 X:150972445-150972467 AGAGAGACAGGATCTCAGGCTGG - Intergenic
1199998273 X:153040873-153040895 ACAGAGACAGAATATGCAGCAGG + Intergenic
1200075900 X:153550520-153550542 AGACAGGAAGCACATGAGGCTGG - Intronic
1200610598 Y:5324147-5324169 ATGGAGAAAGAATAAGGGGCAGG + Intronic
1200795372 Y:7336687-7336709 GGAGAGACAGAAAGTGAGGCTGG + Intergenic
1201271113 Y:12254619-12254641 AGAGAAACAGAAAATGAGGTGGG + Intergenic
1201669324 Y:16499787-16499809 AGAGAGAAAGAAACTTATGCAGG + Intergenic
1201733709 Y:17234454-17234476 AGAGAGAAAGAAAGAGAGGAAGG - Intergenic