ID: 1065035815

View in Genome Browser
Species Human (GRCh38)
Location 10:21637793-21637815
Sequence CACTACACACTGATGGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065035815_1065035820 0 Left 1065035815 10:21637793-21637815 CCAAGTACCATCAGTGTGTAGTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1065035820 10:21637816-21637838 GATTTAGTCTGTAACAGCTGGGG No data
1065035815_1065035821 29 Left 1065035815 10:21637793-21637815 CCAAGTACCATCAGTGTGTAGTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1065035821 10:21637845-21637867 GAGCAATAACTAAACTCACTTGG No data
1065035815_1065035818 -2 Left 1065035815 10:21637793-21637815 CCAAGTACCATCAGTGTGTAGTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1065035818 10:21637814-21637836 TGGATTTAGTCTGTAACAGCTGG No data
1065035815_1065035819 -1 Left 1065035815 10:21637793-21637815 CCAAGTACCATCAGTGTGTAGTG 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1065035819 10:21637815-21637837 GGATTTAGTCTGTAACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065035815 Original CRISPR CACTACACACTGATGGTACT TGG (reversed) Intronic
909303298 1:74040007-74040029 CACAGCACACTGATGGGTCTTGG - Intronic
910289873 1:85589324-85589346 GACTCAACACAGATGGTACTAGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
913793151 1:122565312-122565334 CACTACACAAGGAAGTTACTGGG - Intergenic
913794537 1:122590136-122590158 CACAACACAAGGAAGGTACTGGG - Intergenic
913810283 1:122873340-122873362 CACAACACAAGGATGTTACTGGG - Intergenic
913812852 1:122919236-122919258 CACAACACAAGGATGTTACTGGG - Intergenic
913815949 1:122974652-122974674 CACAACACAATGAAGTTACTGGG - Intergenic
913819528 1:123038189-123038211 CACAACACAAGGATGTTACTGGG - Intergenic
913823231 1:123104646-123104668 CACTACACAAGGAAGTTACTGGG - Intergenic
913830050 1:123227336-123227358 CACAACACACGGAAGTTACTGGG - Intergenic
913830816 1:123241267-123241289 CACAACACAATGAAGTTACTGGG - Intergenic
913835092 1:123317403-123317425 CACAACACAAGGAAGGTACTGGG - Intergenic
913835610 1:123326582-123326604 CACAACACAAGGATGTTACTGGG - Intergenic
913837096 1:123353090-123353112 CACAACACAATGAAGTTACTGGG - Intergenic
913837422 1:123358860-123358882 CACAACACAAGGATGTTACTGGG - Intergenic
913839231 1:123391136-123391158 CACAACACAAGGAAGGTACTGGG - Intergenic
913844662 1:123488513-123488535 CACAACACAAGGATGTTACTGGG - Intergenic
913849966 1:123584357-123584379 CACAACACAAGGATGTTACTGGG - Intergenic
913860591 1:123774880-123774902 CACAACACAAGGATGTTACTGGG - Intergenic
913862447 1:123808018-123808040 CACAACACAAGGAAGGTACTGGG - Intergenic
913863628 1:123829085-123829107 CACAACACAATGAAGTTACTGGG - Intergenic
913873114 1:124000030-124000052 CACAACACAAGGATGTTACTGGG - Intergenic
913873171 1:124001050-124001072 CACTACACAAGGAAGTTACTGGG - Intergenic
913875239 1:124038094-124038116 CACAACACAATGAAGTTACTGGG - Intergenic
913877285 1:124074480-124074502 CACAACACAAGGAAGGTACTGGG - Intergenic
913880752 1:124136277-124136299 CACAACACAATGAAGTTACTGGG - Intergenic
913888091 1:124267586-124267608 CACAACACAATGAAGTTACTGGG - Intergenic
913890879 1:124317568-124317590 CACAACACAATGAAGTTACTGGG - Intergenic
913896362 1:124415994-124416016 CACAACACAATGAAGTTACTGGG - Intergenic
913909768 1:124656286-124656308 CACAACACAATGAAGTTACTGGG - Intergenic
913912730 1:124709311-124709333 CACAACACAATGAAGTTACTGGG - Intergenic
914430756 1:147619045-147619067 CACTGCCCCCAGATGGTACTGGG + Exonic
918612606 1:186510321-186510343 TACAGCACACTGATGGGACTTGG + Intergenic
918616375 1:186549221-186549243 TACAGCACACTGATGGGACTTGG + Intergenic
921786943 1:219242605-219242627 CAATACACAATGATGGAACAGGG - Intergenic
923113995 1:230917252-230917274 CACAACATACTGATAGCACTAGG + Intronic
1065035815 10:21637793-21637815 CACTACACACTGATGGTACTTGG - Intronic
1066472596 10:35713431-35713453 CACTACAAACTGATTTTGCTAGG - Intergenic
1071924937 10:90395382-90395404 CACCAGACACTGATTATACTGGG - Intergenic
1079518311 11:21293908-21293930 CATTACACACTGAAGCTTCTTGG + Intronic
1086606675 11:88704000-88704022 CACCAAACACTGAAGCTACTAGG - Intronic
1087114146 11:94505972-94505994 TACTACACACTTAGGCTACTTGG - Intergenic
1087557768 11:99744403-99744425 CACTAAACAATGTTGGGACTGGG + Intronic
1087710036 11:101537915-101537937 AACTACATATTGATGGTACATGG - Intronic
1087765503 11:102148503-102148525 TGCTACACACTGATGGTTTTTGG + Intronic
1087959277 11:104327633-104327655 CATTGCACACATATGGTACTTGG + Intergenic
1088553209 11:111035940-111035962 TTCTACACACTGAGGGTTCTGGG - Intergenic
1089647430 11:119889433-119889455 CATCACACACTGAGGGGACTGGG - Intergenic
1090919482 11:131195445-131195467 CTCTACACTCTGATAATACTAGG + Intergenic
1102205023 12:111084298-111084320 CCCTAGAAACAGATGGTACTTGG - Intronic
1103486127 12:121283918-121283940 AACTGCACACTGATAGCACTGGG + Intronic
1105863091 13:24434288-24434310 CACTACAGACTGATGATAGACGG + Intronic
1107671119 13:42747353-42747375 CAATACACTCTGATGGTAGATGG + Intergenic
1109408415 13:61932409-61932431 CTCTTCACACTCATGGGACTAGG + Intergenic
1109702199 13:66040806-66040828 AACTCCACAATGATGGTATTAGG - Intergenic
1110439678 13:75513675-75513697 CAATACACACTGATGGATCAGGG + Intergenic
1112993570 13:105544601-105544623 CCCCACTCACTGATGGCACTGGG - Intergenic
1120191336 14:81442796-81442818 CACGACAAACTGATTTTACTTGG - Intergenic
1122160482 14:99780834-99780856 CACTACACACTTAGGCTACATGG - Intronic
1125959023 15:43813241-43813263 AAGTACACACTCAAGGTACTGGG - Exonic
1129577381 15:76764627-76764649 CACTACAAACTGATAGTCTTAGG + Intronic
1131947306 15:97638752-97638774 CACGGCACCCTGTTGGTACTTGG - Intergenic
1134859580 16:17549134-17549156 GATTACATCCTGATGGTACTGGG + Intergenic
1139548899 16:67662670-67662692 CACTCCACACTGCTGGGACATGG + Exonic
1140784515 16:78327420-78327442 CCTTCCACACTGAGGGTACTGGG - Intronic
1144878612 17:18418601-18418623 AACTGAACACTGATGCTACTTGG + Intergenic
1144885141 17:18452639-18452661 AACTGAACACTGATGCTACTTGG - Intergenic
1145147076 17:20491738-20491760 AACTGAACACTGATGCTACTTGG + Intergenic
1145177037 17:20709485-20709507 AACTGAACACTGATGCTACTTGG - Intergenic
1145177146 17:20710831-20710853 AACTGAACACTGATGCTACTTGG + Intergenic
1146853230 17:36241386-36241408 AACTAAACACTGATGCTACTTGG - Intronic
1146869138 17:36365276-36365298 AACTAAACACTGATGCTACTTGG - Intronic
1147058647 17:37855522-37855544 AACTAAACACTGATGCTACTTGG + Intergenic
1147072012 17:37965907-37965929 AACTAAACACTGATGCTACTTGG - Intergenic
1147083538 17:38045439-38045461 AACTAAACACTGATGCTACTTGG - Intronic
1147099484 17:38169406-38169428 AACTAAACACTGATGCTACTTGG - Intergenic
1150082497 17:62252694-62252716 AACTAAACACTGATGCTACTTGG - Intergenic
1151133152 17:71919220-71919242 CAGAAAACACTGATGGTACAGGG + Intergenic
1157686691 18:49648449-49648471 CACTCCACACTCATGGAGCTGGG + Intergenic
1158927708 18:62285905-62285927 CACTACACACATATTGTCCTGGG - Intronic
927330786 2:21861035-21861057 CACTACTCAGAGAAGGTACTTGG + Intergenic
927643096 2:24858072-24858094 CACTGCACACTGATCTTGCTGGG + Intronic
929762575 2:44818200-44818222 CACTACTCACAAATGGTGCTAGG - Intergenic
930004394 2:46884633-46884655 CTCTACACACTGCTGGTACTGGG - Intergenic
932070056 2:68611066-68611088 TACTTCAAACTGAGGGTACTTGG - Intronic
932227631 2:70055263-70055285 CACTACACTCTGATGCCACTGGG + Intergenic
933652233 2:84858782-84858804 CTTTACACACTGAAGGTCCTGGG + Intronic
941761045 2:169243901-169243923 GTCTACACACTGTTGCTACTAGG - Intronic
944434452 2:199672084-199672106 GACTACACTCTGTTTGTACTGGG + Intergenic
944678878 2:202057996-202058018 CACTACCAACTGATTGAACTTGG + Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1184908068 22:47505068-47505090 CTCTACACACTTATTGTACAAGG + Intergenic
949231085 3:1751805-1751827 CACTACACAATCATGTTCCTAGG + Intergenic
949766842 3:7536093-7536115 CACCACACACTTTTGGTACTAGG - Intronic
954461486 3:50629430-50629452 CAGTGCACACTGAAGGTATTGGG - Intronic
960084239 3:113573592-113573614 ATCTCCACAGTGATGGTACTTGG + Intronic
960302501 3:116021005-116021027 TAGGAGACACTGATGGTACTTGG + Intronic
960971539 3:123143430-123143452 CACTACACACTCATCATGCTGGG - Intronic
962885076 3:139617153-139617175 CTGTTCACACTGATGGCACTGGG + Intronic
963227373 3:142876053-142876075 GTCTACCCACTGATGGTTCTTGG - Intronic
970207552 4:13669947-13669969 CACCCCAATCTGATGGTACTTGG - Intergenic
970325771 4:14922003-14922025 CACTACACACAGAGGCTACATGG - Intergenic
971810212 4:31415477-31415499 CACCACACACTGATTCAACTTGG + Intergenic
972141177 4:35961382-35961404 CACTACACACTGATTATAATGGG - Intronic
973153524 4:46918059-46918081 CACTTCAAATTTATGGTACTTGG - Intergenic
974030757 4:56774206-56774228 GACTAGAAAGTGATGGTACTTGG - Intergenic
974837778 4:67271916-67271938 CACTACACAATAATGGTAAAGGG - Intergenic
978825853 4:113022526-113022548 CACTAGACACTGAGTGTACATGG + Intronic
980048587 4:128015904-128015926 CACTATATACGGATGGTTCTAGG + Intronic
980617955 4:135257690-135257712 CACTACACTCTGATTGAGCTTGG + Intergenic
980638323 4:135538850-135538872 CAATACATACTGAGGGAACTCGG + Intergenic
985307735 4:188562181-188562203 TACAACACACTGATGGGTCTTGG + Intergenic
985425309 4:189824515-189824537 CACTGTACACTAATGTTACTTGG - Intergenic
987168024 5:15221118-15221140 CTCTACTCACTGATGGTAAAGGG - Intergenic
987475740 5:18390485-18390507 TACTACACACTTAGGGTCCTAGG + Intergenic
989476453 5:41879758-41879780 CACTGCATACTTATGGTCCTAGG - Intergenic
990543763 5:56801534-56801556 CACTACACACTGCTGCTTCCAGG - Intergenic
997755534 5:136395190-136395212 CACTATACACTGATTATAATTGG + Intronic
1005100730 6:22170286-22170308 TACAACACACTGATGGGACTTGG + Intergenic
1006896444 6:37474415-37474437 AGCTACAAACTGATGGGACTGGG - Intronic
1013769196 6:113608491-113608513 CACCAGCCACTGATGGTACTTGG - Intergenic
1014897631 6:126922658-126922680 CACTTCCCACTGATGGGGCTGGG - Intergenic
1015063141 6:128992672-128992694 CACTACACAATTAAGGTAATTGG - Intronic
1017548962 6:155483517-155483539 CACCACAAAGTGATGGTATTAGG + Intergenic
1018775080 6:167007227-167007249 CACTACACAGGCATGCTACTGGG - Intronic
1026361374 7:69603838-69603860 CAGGACACACTGATGGTAGTAGG - Intronic
1029293514 7:99520508-99520530 GATTAAACACTGATAGTACTTGG + Intronic
1039073548 8:33667805-33667827 CACTACACCCAGCTGGTACTTGG + Intergenic
1041184358 8:55283840-55283862 CATTTCACAATGATGCTACTGGG + Intronic
1045592520 8:103613792-103613814 CAAGACACACTCATGGTCCTGGG + Intronic
1048274297 8:133054402-133054424 CACTACACAGTGATGCGATTTGG + Intronic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1060696205 9:125711133-125711155 TACAGCACACTGATGGTGCTGGG + Intergenic
1203339101 Un_KI270303v1:615-637 CACAACACAATGAAGTTACTGGG + Intergenic
1203340401 Un_KI270315v1:1677-1699 CACAACACACGGAAGTTACTGGG - Intergenic
1185689167 X:2139149-2139171 CAATCCTCACTGATGGCACTAGG - Intergenic
1189439786 X:41024981-41025003 CACTACACACTGCAGGAGCTGGG - Intergenic
1191227954 X:58065482-58065504 CAATAAACACTGAGGGAACTCGG - Intergenic