ID: 1065045887

View in Genome Browser
Species Human (GRCh38)
Location 10:21747445-21747467
Sequence CTCCTTAGGAACTCTGAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065045887_1065045894 -9 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045894 10:21747459-21747481 CCTAAGGAGTGGCGGAGGCTGGG No data
1065045887_1065045892 -10 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045892 10:21747458-21747480 TCCTAAGGAGTGGCGGAGGCTGG No data
1065045887_1065045901 27 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045901 10:21747495-21747517 ATTGAGGCCTCTCGGGGTGTGGG No data
1065045887_1065045899 21 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045899 10:21747489-21747511 TTCAAGATTGAGGCCTCTCGGGG No data
1065045887_1065045898 20 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045898 10:21747488-21747510 CTTCAAGATTGAGGCCTCTCGGG No data
1065045887_1065045897 19 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045897 10:21747487-21747509 TCTTCAAGATTGAGGCCTCTCGG No data
1065045887_1065045895 11 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045895 10:21747479-21747501 GGGATGCCTCTTCAAGATTGAGG No data
1065045887_1065045900 26 Left 1065045887 10:21747445-21747467 CCCGACTCAGAGTTCCTAAGGAG No data
Right 1065045900 10:21747494-21747516 GATTGAGGCCTCTCGGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065045887 Original CRISPR CTCCTTAGGAACTCTGAGTC GGG (reversed) Intergenic
No off target data available for this crispr