ID: 1065048632

View in Genome Browser
Species Human (GRCh38)
Location 10:21767264-21767286
Sequence GTGGATCCACAGAAAGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065048627_1065048632 10 Left 1065048627 10:21767231-21767253 CCCAAGAACCATGATACCTTTAC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG No data
1065048628_1065048632 9 Left 1065048628 10:21767232-21767254 CCAAGAACCATGATACCTTTACA 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG No data
1065048629_1065048632 2 Left 1065048629 10:21767239-21767261 CCATGATACCTTTACACATATGA 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG No data
1065048631_1065048632 -6 Left 1065048631 10:21767247-21767269 CCTTTACACATATGAGTGTGGAT 0: 1
1: 0
2: 0
3: 10
4: 153
Right 1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065048632 Original CRISPR GTGGATCCACAGAAAGAATT TGG Intronic
No off target data available for this crispr