ID: 1065050324

View in Genome Browser
Species Human (GRCh38)
Location 10:21785423-21785445
Sequence CTGTGGAAGAAGAAAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065050321_1065050324 -4 Left 1065050321 10:21785404-21785426 CCTCTTCAAGGTGTGTCCTCTGT 0: 1
1: 0
2: 0
3: 22
4: 192
Right 1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG No data
1065050320_1065050324 4 Left 1065050320 10:21785396-21785418 CCTTTGCTCCTCTTCAAGGTGTG 0: 1
1: 0
2: 1
3: 19
4: 205
Right 1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG No data
1065050318_1065050324 22 Left 1065050318 10:21785378-21785400 CCTCTCTCTCAACTATTGCCTTT 0: 1
1: 0
2: 0
3: 24
4: 292
Right 1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065050324 Original CRISPR CTGTGGAAGAAGAAAACTGA AGG Intronic
No off target data available for this crispr