ID: 1065053051

View in Genome Browser
Species Human (GRCh38)
Location 10:21815479-21815501
Sequence AACTCCTGTGTCAGAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065053051_1065053054 13 Left 1065053051 10:21815479-21815501 CCTCTATCTCTGACACAGGAGTT 0: 1
1: 0
2: 6
3: 34
4: 224
Right 1065053054 10:21815515-21815537 CAGCAGTATCTATGAAACTAGGG No data
1065053051_1065053053 12 Left 1065053051 10:21815479-21815501 CCTCTATCTCTGACACAGGAGTT 0: 1
1: 0
2: 6
3: 34
4: 224
Right 1065053053 10:21815514-21815536 CCAGCAGTATCTATGAAACTAGG No data
1065053051_1065053055 17 Left 1065053051 10:21815479-21815501 CCTCTATCTCTGACACAGGAGTT 0: 1
1: 0
2: 6
3: 34
4: 224
Right 1065053055 10:21815519-21815541 AGTATCTATGAAACTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065053051 Original CRISPR AACTCCTGTGTCAGAGATAG AGG (reversed) Intronic
900426734 1:2583857-2583879 AACTCCGGGGTCAGAGACAAAGG - Intergenic
905677971 1:39843146-39843168 AACTCCATTGTCAGAGACTGGGG - Intronic
906459606 1:46027322-46027344 TACTCCTGTTTCAGGGAGAGGGG - Intronic
907142437 1:52200668-52200690 AACTCCTGTGAAAGGTATAGGGG + Intronic
907576489 1:55530789-55530811 GACTCCTGGGTCAGAGACAAAGG + Intergenic
909545293 1:76839913-76839935 GACTCCTGGGTCAGAGACAAAGG - Intergenic
910722697 1:90304082-90304104 AAGCCCTGTGTCAAAGATGGTGG - Intergenic
911127411 1:94353324-94353346 GACTCCTGGGTCAGAGTTAAAGG - Intergenic
914998551 1:152565982-152566004 AACTCCTGTGACAGGGGCAGTGG - Exonic
914999903 1:152579710-152579732 AACTCCTGTGACAGGGGCAGTGG - Exonic
915001814 1:152600942-152600964 AACTCCTGTGACAGGGGCAGTGG + Exonic
915003401 1:152614024-152614046 AACTCCTGTGACAGAGGCAGTGG + Exonic
915004344 1:152622886-152622908 AACTCCTGTGACAGGGGAAGTGG - Exonic
915983451 1:160438628-160438650 GACTCCTGGGTCAGAGACAAAGG + Intergenic
917198520 1:172491927-172491949 AACTCATCTGTCAGAAACAGAGG + Intergenic
920744262 1:208611179-208611201 AATTCATGTGTTAGAGATGGAGG - Intergenic
921280290 1:213560016-213560038 AACTCTTGGTTCAGAGATAAAGG + Intergenic
921795739 1:219342510-219342532 GACTCCTGGGTCAGAGACAATGG - Intergenic
922087856 1:222368335-222368357 AAGTCTTCTGCCAGAGATAGAGG - Intergenic
922241256 1:223756740-223756762 AGCTCCTGTTTCAGAGACGGAGG - Intronic
923066121 1:230518900-230518922 AACTCCTATCTCAGAGGTATAGG - Intergenic
1063072130 10:2677398-2677420 GAGTCCTGGGTCAGAGATAAAGG + Intergenic
1063597870 10:7453487-7453509 AACTCCTGGGTCAGAGACAAAGG + Intergenic
1063621663 10:7654700-7654722 GACTCCTGGGTCAGAGACAAAGG - Intronic
1063872171 10:10429698-10429720 GACTCCTGGGTCAGAGAAAAAGG + Intergenic
1064093520 10:12405695-12405717 AACTCCTGTCTCATAGATACTGG - Intronic
1065052895 10:21813932-21813954 GACTCCTGGGTCAGAGACAAAGG - Intronic
1065053051 10:21815479-21815501 AACTCCTGTGTCAGAGATAGAGG - Intronic
1065541919 10:26779012-26779034 GACTCCTGGGTCAGAGACAAAGG - Intronic
1067366724 10:45637875-45637897 AAGTCCTTTGTCAGATATATGGG - Intronic
1067787077 10:49258221-49258243 GAATCCTGTGGCAGAGATAGTGG + Intergenic
1069311591 10:67044580-67044602 AAATCCTGTCTCTGAGACAGAGG - Intronic
1070671114 10:78377781-78377803 AAGGCCTGTGTCAGATACAGAGG + Intergenic
1072699178 10:97627732-97627754 ATCTTCTGTGTGAGAGATACTGG - Intronic
1073397455 10:103229912-103229934 AAATGCTGAGTCACAGATAGGGG - Intergenic
1074495111 10:113973443-113973465 GACTCCTGGGTCAGAGACAAAGG - Intergenic
1078780882 11:14438483-14438505 TCTTCCTATGTCAGAGATAGTGG - Intergenic
1081380353 11:42407358-42407380 AACTCATGTGTTGGAGAGAGAGG - Intergenic
1081881437 11:46456285-46456307 AAGTCTTTTGTCAGAGGTAGAGG - Intronic
1084068433 11:66718787-66718809 AACTCCTGAGACAGAGAGTGGGG + Intronic
1086512757 11:87577444-87577466 AACTCCTGGGTCAGAGACAAAGG + Intergenic
1089568430 11:119385635-119385657 AACTACTGTGTGAGAGAGTGGGG + Intergenic
1089663361 11:120000482-120000504 AACTCCTGGGTCAGAGACAAAGG - Intergenic
1093671826 12:21885524-21885546 AACTTGTCTTTCAGAGATAGGGG - Intronic
1093770736 12:23014747-23014769 GACTCCTGGGTCAGAGACATAGG + Intergenic
1094458811 12:30670806-30670828 AAGTCCTATGTCAGATATAAAGG - Intronic
1097275490 12:57810625-57810647 AACTCCTGTGTCTGGGATCTAGG - Intronic
1097428785 12:59477593-59477615 ACCTCCTGTGTCAGGGTAAGGGG + Intergenic
1098361467 12:69658356-69658378 AACTCCTGGGTCATAGATGGGGG + Intronic
1100038779 12:90285305-90285327 AACTAATGTGTTAGAGAGAGAGG + Intergenic
1100207882 12:92370826-92370848 AAATACAGTGTCAGAGATAGAGG + Intergenic
1101920306 12:108927222-108927244 CACTCCTGGGTCAGAGACAAAGG - Intronic
1102600711 12:114028024-114028046 GACTCCTGGGTCAGAGACAAAGG + Intergenic
1103898181 12:124288198-124288220 GACTCCTGGGTCAGAGACAAAGG + Intronic
1104400280 12:128470215-128470237 AACTGCTGAGGCAGAGAAAGTGG + Intronic
1105458661 13:20564406-20564428 AACACCTGAGTCAGAGAGAAAGG + Intergenic
1106589779 13:31089368-31089390 CACTCCTGTGCCTGAGACAGAGG + Intergenic
1106867237 13:33978833-33978855 AAGGCCTGAGTCAGAGAAAGAGG - Intergenic
1107051405 13:36054352-36054374 AACTCCTGGGTCAGAAATGAAGG - Intronic
1107757954 13:43646210-43646232 AACTCCTGGATCAGACATAAAGG - Intronic
1107845405 13:44507518-44507540 ATCTCCTGTGTTAGCTATAGGGG - Intronic
1107988373 13:45795615-45795637 GACTCCTGGGTCAGAGATGAAGG - Intronic
1108251985 13:48576787-48576809 GACTCCTGAGTCAGAGACAAGGG - Intergenic
1108926189 13:55748938-55748960 GACTCCTGTGTCAGAAACAAAGG - Intergenic
1108972172 13:56391529-56391551 GATTCCTGGGTCAGAGACAGAGG + Intergenic
1109436250 13:62307324-62307346 GATTCCTGTGTCAGAGAAAATGG - Intergenic
1109956447 13:69573592-69573614 GATTCCTGTGTCAGAGAAAAAGG + Intergenic
1110273094 13:73613529-73613551 GACTCCTGGGTCAGAGATGAAGG + Intergenic
1111285579 13:86088206-86088228 AACTCCTGGGTCAGAGACAGAGG - Intergenic
1111907815 13:94276045-94276067 AACTGCTGGGTCAAAGATATGGG - Intronic
1112208176 13:97346625-97346647 AATGACTGTGTCAGAGATTGTGG + Intronic
1112267147 13:97934811-97934833 GATTCCTGTGTCAGAGATAAAGG - Intergenic
1112733199 13:102389866-102389888 GACTCCTGGGTCAGAGACAGGGG - Intronic
1112843587 13:103609837-103609859 AGCTCCTGGGTCAGAGAAAAAGG - Intergenic
1112992439 13:105530376-105530398 AACTTCTGGGTCAGAGAAACAGG - Intergenic
1114392600 14:22326341-22326363 AACTCCTTTGTGAGACATTGGGG - Intergenic
1114750013 14:25193431-25193453 AACTCTTGTGTCAGAGACAAAGG + Intergenic
1115066439 14:29267251-29267273 AGCTCCTGTGTCAGAAATCAGGG - Intergenic
1116988870 14:51251876-51251898 AACCCCTGTCTTAGAGAAAGTGG + Intronic
1119771454 14:77222612-77222634 GACTCATGTGGCAGGGATAGGGG - Intronic
1119785943 14:77314402-77314424 AAGTCTTGGGTCAGAGACAGAGG - Intronic
1120274781 14:82358732-82358754 AAATCCTCTGTCAGATACAGAGG - Intergenic
1122185282 14:99987990-99988012 AACTCAGGGGGCAGAGATAGTGG - Intronic
1122631726 14:103110315-103110337 AACTGCAGTGTCAGAGTTGGGGG - Intronic
1122876305 14:104667263-104667285 AAATATTGTGTCAGAGTTAGTGG - Intergenic
1124050583 15:26193845-26193867 GACTCCTGTGTCAGAGATGAAGG + Intergenic
1126158674 15:45588179-45588201 ACCTCCTGTTTCAGAAATATAGG + Intronic
1126780079 15:52132223-52132245 GACTCCTGGGTCAGAGATGAAGG - Intronic
1128336727 15:66791218-66791240 GACTCCTGGGTCAGAGACAAAGG - Intergenic
1129805448 15:78452849-78452871 AACTCCTGGATCAGAGACAATGG + Intronic
1129899231 15:79133006-79133028 GACTCCTGGGTCAGAGAAAAAGG - Intergenic
1130249301 15:82286734-82286756 AAGTCCTGTGTCTGTGATACAGG - Intergenic
1131753182 15:95531948-95531970 GACTTTTGTGTTAGAGATAGGGG - Intergenic
1135019416 16:18951101-18951123 AAGTCCTGTGGCATAAATAGAGG - Intergenic
1137859935 16:51836434-51836456 GACTCCTGGGTCAGAGACAATGG - Intergenic
1143071993 17:4303689-4303711 CAGTCCTGTGTGAGACATAGAGG - Intronic
1143088768 17:4436104-4436126 ATCTCATGGGGCAGAGATAGAGG + Intronic
1143651154 17:8264951-8264973 AACTCCTCTGGCAGATGTAGCGG + Exonic
1143728324 17:8865470-8865492 CACTCCTGTGGCACAGAGAGAGG + Intronic
1147037278 17:37691113-37691135 ATCAGCTGTGTCAGAGACAGAGG + Intronic
1147746427 17:42697542-42697564 GACTCCTGTCTCTGAGAGAGAGG - Exonic
1150925373 17:69526939-69526961 AAGTCCAGTGATAGAGATAGGGG + Intronic
1153845863 18:9049395-9049417 GACTCCTGAGTCAGAGAAAAAGG + Intergenic
1156395786 18:36698750-36698772 AATTCCTGGGTCAGAGACAAAGG + Intronic
1156878255 18:42043046-42043068 AAATCCTTTGTCAGAAATACAGG + Intronic
1157785268 18:50475966-50475988 AACTCCTGGATCAGAGACAAGGG - Intergenic
1158076135 18:53531822-53531844 TACACCTGTGTCAGAGTCAGGGG + Exonic
1159362699 18:67425998-67426020 GACTCCTGAGTCAGAGACAAAGG - Intergenic
1159539071 18:69752732-69752754 AACTCCTGAGTCAGAGACAGAGG + Intronic
1159587287 18:70292805-70292827 AACTACTGTGTCAAAGGTGGCGG - Intronic
1160003498 18:75050440-75050462 GATTCCTGGGTCAGAGATAAAGG + Intronic
1160106211 18:75979409-75979431 AACTCCTCTTTCAGCGATTGTGG + Intergenic
1160458776 18:79021707-79021729 GACTCCTGGGTCAGAGAGAAAGG + Intergenic
1162188898 19:8929265-8929287 ATCTCCTATGTCAAGGATAGAGG + Intronic
1163187355 19:15648200-15648222 AACTCCTGGGTCAGAGACAAAGG + Intronic
1163217439 19:15891382-15891404 GACTCCTGGGTCAGAGACAAAGG - Intronic
1163818818 19:19484487-19484509 AAATCCTGTGACAGAGAAAAAGG - Intronic
1166679027 19:44756414-44756436 AACTCCTGGGTCTGAGGGAGGGG + Intronic
1166705102 19:44904112-44904134 AACTGCTGTGTCAGGGAGAAGGG + Intergenic
1167396084 19:49229923-49229945 AACTCCTGGGTCAGAGACAAAGG - Intergenic
1168263703 19:55209626-55209648 ATCTCCAGTGTCAGAGCTAGAGG - Intergenic
1168280413 19:55302524-55302546 GACTCCTGGGTCTGAGATGGGGG + Intronic
925412213 2:3646342-3646364 GACTTCTGGGTCAGAGATAAAGG - Intergenic
926664947 2:15511121-15511143 AAGTCCTTTGTAAGATATAGAGG - Intronic
932441792 2:71742168-71742190 GACTCCTGGGTCAGAGACAAAGG - Intergenic
933443477 2:82346057-82346079 AACTCCTAGGTCAGAGAAAAAGG + Intergenic
935403972 2:102689084-102689106 GACTCCTGAGTCAGAGACAAAGG + Intronic
935946211 2:108288943-108288965 TACTACTGTGTCAGAGTTACGGG - Exonic
935960378 2:108419855-108419877 GACTCCTGTGTCAGAGACAAAGG - Intergenic
936240715 2:110786495-110786517 AAATCCTGTCTCAGAAATACCGG + Intronic
937943296 2:127307219-127307241 CACTGATGTGTCAGTGATAGAGG + Exonic
938903377 2:135817353-135817375 CACTCCTGGGTCAGAGATGCCGG + Exonic
939835845 2:147128603-147128625 AACTTCTGACTCAAAGATAGAGG - Intergenic
940525235 2:154806214-154806236 GACTCTTGGGTCAGAGATAAGGG + Intronic
941982429 2:171473624-171473646 AACTCCTGTTTGTGAGATATAGG + Intronic
942844726 2:180409566-180409588 GACTCCTGGGTCAGAGACAAAGG - Intergenic
942959743 2:181815816-181815838 GACTCCTGGGTCAGAGACAGAGG - Intergenic
943668827 2:190638787-190638809 AACTGCAGTCTCAGAGAAAGTGG + Intergenic
943785349 2:191871845-191871867 GACTTCTGGGTCAGAAATAGAGG + Intergenic
944157856 2:196626627-196626649 AACTCCTAGGTCAGAGATAAAGG + Intergenic
944711576 2:202339535-202339557 CACTCCTTGGTCAGAGACAGAGG - Intergenic
946667997 2:222071304-222071326 GACTCCTGGGTCAGAGAAAAAGG + Intergenic
947057723 2:226125964-226125986 AACTCCTGTGTCAGAGACAAAGG - Intergenic
948151089 2:235745551-235745573 AACTGCTTTGTCAGAAATATGGG + Intronic
1169112392 20:3042693-3042715 AAATCCTGTGACAAAGATGGGGG - Intergenic
1169891655 20:10459783-10459805 GGCTCCTGTGTGAGGGATAGTGG + Intronic
1170911564 20:20575740-20575762 AAATCCTGTGTCAGTAATAGGGG - Intronic
1174870467 20:54176526-54176548 AATTCCTGTTTCAGGGATATTGG + Intergenic
1175158877 20:56993301-56993323 GACTACTGGGTCAGAGATAAAGG + Intergenic
1177127222 21:17210166-17210188 GACTCCTGGGTCAGAGAGAAAGG - Intergenic
1177667742 21:24183186-24183208 GATTTCTGTGTCAGAGGTAGGGG - Intergenic
1178705107 21:34866631-34866653 AACTCCACTGTCAAAAATAGTGG - Intronic
1180830371 22:18902790-18902812 CACACCTGTGTCAGAGAAAGGGG + Intergenic
1181069341 22:20322741-20322763 CACAGCTGTGTCAGAGACAGGGG - Intergenic
1181331928 22:22099344-22099366 AACCCCTGCGTCAGAGACTGGGG - Intergenic
1184873879 22:47260203-47260225 AACTTCTCTGTGAGAGATAAGGG - Intergenic
1185147500 22:49147244-49147266 AACTCCAGTGTGGGAGAGAGGGG + Intergenic
1185377826 22:50490187-50490209 AGCTCCTGTGTCAGAGCCTGGGG + Intronic
1203280460 22_KI270734v1_random:128061-128083 CACACCTGTGTCAGAGAAAGGGG + Intergenic
950830593 3:15871797-15871819 AACTCCTGGGTCAAAGACAAAGG + Intergenic
951781847 3:26372285-26372307 AACTCCAGTGACAGAAATAAAGG + Intergenic
952711353 3:36435252-36435274 GTCTCCTGAGTCAGAGACAGTGG - Intronic
953159065 3:40401315-40401337 GACTCCTGGGTCAGAAATAAAGG + Intronic
953520061 3:43633738-43633760 GACTCCTGGGTCAGAGACAAAGG + Intronic
953529440 3:43726864-43726886 CACTCCCGTGTCAGACATTGAGG - Intronic
953597302 3:44329625-44329647 GACTCCTGTGTCGGAGACAGAGG + Intronic
953688930 3:45101067-45101089 GACTGCTGTGTCACAAATAGAGG - Intronic
955146697 3:56326887-56326909 AAATCCAGTTTCAGAGAAAGAGG - Intronic
955374985 3:58387253-58387275 AGTTCCTGTGTCAGAACTAGAGG + Intronic
956095795 3:65714555-65714577 GACTCTTGGGTCAGAGATAAAGG - Intronic
958029031 3:88084724-88084746 AACTCTTGAGTCAGAGATAATGG + Intronic
959213844 3:103424338-103424360 GACTCCTGGGTCAGAGACAGAGG + Intergenic
960032814 3:113071846-113071868 AACTCCTCAGTCAGAAAGAGTGG - Intergenic
960255558 3:115507156-115507178 AACTCCTGGTTCAGAGAGAAAGG - Intergenic
962608775 3:137055313-137055335 AGTTCCTGGGTCAGAGAGAGGGG + Intergenic
963211001 3:142689871-142689893 TACTTCACTGTCAGAGATAGGGG + Intronic
967772545 3:193350513-193350535 AATTCCTGTGTGGGAGTTAGGGG - Intronic
970271190 4:14349489-14349511 AACTCTAGTCTCAGAGAGAGAGG + Intergenic
970599270 4:17627988-17628010 AACACCTATGTTAGAGAAAGGGG - Exonic
971140180 4:23916953-23916975 AACTACTGAGTCAGAACTAGGGG + Intergenic
971601875 4:28602489-28602511 AATTCCTGACTCAGATATAGTGG - Intergenic
972117705 4:35657935-35657957 GACTCCTGGGTAAGAGATAAAGG + Intergenic
972786376 4:42330201-42330223 AACTTCTGTGTTAGGGAAAGCGG - Intergenic
975122905 4:70748597-70748619 GACTCCTAGGTCAGAGATAAAGG + Intronic
977511112 4:97964129-97964151 AACTCCTGAGTCAGAGACAAAGG + Intronic
977797563 4:101185407-101185429 AAGTACTGTGTTAGAGATATTGG - Intronic
978359703 4:107917200-107917222 GACTCCTGAGTCAGAGACAAAGG - Intergenic
979303837 4:119119559-119119581 AACTCCTGGGTCAGAGATAAAGG - Intergenic
979414770 4:120422984-120423006 GACTCCTGAATCAGAGACAGAGG + Intergenic
979466874 4:121049524-121049546 TACTCCTGGGTCAGAGACAAAGG - Intronic
980567601 4:134564238-134564260 AACTCCTGGGTAAGAGTTTGAGG - Intergenic
980955163 4:139420534-139420556 GACTCCTGGGTCAGAGACAAAGG - Intergenic
981438398 4:144753413-144753435 GACTCCTGGGTCAGAGACAAAGG + Intergenic
983376380 4:166933968-166933990 CACTCCTGGGTCACAGATAGAGG - Intronic
983418302 4:167485442-167485464 AAGCCCTGTGTCAGGGACAGGGG + Intergenic
984049005 4:174840956-174840978 AACTCATCTGTTAGAGATACAGG - Intronic
984256672 4:177397944-177397966 AACTCCTGGGTCAGAGACAAAGG + Intergenic
986979138 5:13426818-13426840 GACTCCTAGGTCAGAGACAGAGG + Intergenic
987933742 5:24435926-24435948 GACTCCTGGGTCACAGATAAAGG + Intergenic
988969468 5:36451700-36451722 GACTCCTGTGTCAAAGACAAAGG + Intergenic
989571794 5:42952260-42952282 TACTCCTTTGTCAGCGACAGCGG - Intergenic
992084044 5:73261999-73262021 AACTCCTGGGTCAGAGATAAAGG + Intergenic
996691256 5:126342735-126342757 AAATTCCGTGTCAAAGATAGGGG + Intergenic
999589607 5:153130630-153130652 AACTCCTGTGTGAGAGAGAGAGG - Intergenic
1000939772 5:167346681-167346703 GCCTCCTGGGTCAGAGACAGAGG + Intronic
1001315763 5:170640227-170640249 AACTCCTGAGACAGGGACAGTGG + Intronic
1002108568 5:176892657-176892679 AACTCCTGTGTGACAGGAAGTGG - Intronic
1002472542 5:179444962-179444984 GATTCCTGTGTCAGAGACAAAGG + Intergenic
1002481579 5:179504694-179504716 GATTCCTGTGTCAGAGACAAAGG - Intergenic
1003864791 6:10353119-10353141 AACTCCTGGGTCAGAGACAAAGG - Intergenic
1007386697 6:41524924-41524946 AACTCAAGAGTCAGAGATCGGGG + Intergenic
1007846446 6:44761155-44761177 AAATCCTGTGGTATAGATAGTGG - Intergenic
1009920323 6:70051370-70051392 AACTTCTGAGTCAGAGAAAAAGG + Intronic
1011557808 6:88587928-88587950 AAGTCCTGTGACAGGGACAGGGG - Intergenic
1012098672 6:94999986-95000008 GACTACTGAGTCAGAGATAAAGG - Intergenic
1017963775 6:159246257-159246279 ATCTCCTGAGTCAGTGAGAGTGG + Intronic
1019987755 7:4670207-4670229 AAATGCTGTATCAGAGAGAGGGG - Intergenic
1020727543 7:11834025-11834047 ACTTCCTGTGCCAGAGTTAGAGG - Intergenic
1025900967 7:65744529-65744551 GACTCCTGGGTCAGAGACAAAGG + Intergenic
1026678563 7:72448389-72448411 AGTTCCTGTGTCAGGGATAGAGG + Intergenic
1027001342 7:74657026-74657048 AAATCCTGAGGGAGAGATAGAGG + Intergenic
1028213064 7:88099277-88099299 AACTCCTGGGTCAGAGACGAAGG + Intronic
1028749414 7:94365843-94365865 GACTCCTGGGTCAGAGACAAAGG - Intergenic
1029014034 7:97295500-97295522 GACTCCTGGGTCAGAGACTGAGG + Intergenic
1030021669 7:105281103-105281125 GACTCCTGTCTCAGAAAAAGCGG - Intronic
1030327124 7:108232092-108232114 AAGTCCTGTGTAAGACATTGGGG - Intronic
1030758676 7:113322263-113322285 GACTCCTGAGTCAGAGACAAGGG - Intergenic
1031359416 7:120829993-120830015 AAATGTTGTGTCAGAGACAGGGG - Intronic
1031521696 7:122775301-122775323 GGCTCCTGGGTCAGAGATAAAGG + Intronic
1032471871 7:132184694-132184716 AACACCTGTCTCAGAGGGAGGGG - Intronic
1033791154 7:144793459-144793481 GACTCCTGAGTCAGAGATGAAGG - Intronic
1034066770 7:148144479-148144501 AACTCCTGGGTCAGAGACAAAGG - Intronic
1036115256 8:5952286-5952308 AAATAGTGTGTCAGAGAGAGGGG - Intergenic
1037152060 8:15648945-15648967 GACTCCTGGGTCAGAGAAAAGGG - Intronic
1037655543 8:20880933-20880955 AAGTGCTGTGTCTGAAATAGGGG + Intergenic
1038404662 8:27312525-27312547 AACTCCTGGGTCAGAGACAAAGG - Intronic
1045036621 8:98181127-98181149 AAATCCTGTCCCATAGATAGTGG + Intergenic
1046071404 8:109259347-109259369 AACTCCTGTGTCAGACACAAAGG - Intronic
1047256783 8:123219591-123219613 GACTCCTGGGTCAGAGACAAAGG - Intergenic
1047950730 8:129932602-129932624 AACTCCTGTGTTAAAGATCAAGG - Intronic
1049316954 8:141974428-141974450 ACCTCCTGTGTCTGCAATAGAGG - Intergenic
1049797251 8:144502490-144502512 GACTCTTGTGTCAGAGCCAGAGG + Intergenic
1050221935 9:3401095-3401117 AACTTTGGTGTCAGAGAGAGGGG - Intronic
1050348776 9:4719707-4719729 AAGTCCTGTGTCCCAGTTAGAGG - Intronic
1050413039 9:5386135-5386157 GACTCCTGGGTCAGAGAAAAAGG - Intronic
1050771742 9:9209858-9209880 AACTCCTGGGTCAGATACAAAGG + Intronic
1052612636 9:30795613-30795635 AATTACTTTCTCAGAGATAGAGG - Intergenic
1052748807 9:32467928-32467950 CATTCCTGTGTCAGAGTAAGAGG + Exonic
1052825842 9:33173793-33173815 AACTCTTGTGTCAGAAAGTGAGG + Intergenic
1054727969 9:68671416-68671438 AACTCCTGGGTCAGAGACAAAGG - Intergenic
1058737929 9:107912360-107912382 GACTCCTGGGTCAGAGACAAAGG + Intergenic
1059953350 9:119490583-119490605 ACCTCCAGTGTTGGAGATAGGGG - Intergenic
1060590862 9:124815902-124815924 CACTCCTGGGTCAGAGAATGTGG + Intergenic
1062364389 9:136202049-136202071 GGCTCCTGTGTCAGGGATGGCGG + Intronic
1186633725 X:11379299-11379321 GACTCCAGAGTCAGAGTTAGAGG + Intronic
1186799214 X:13076479-13076501 GACTCCTGGGTCAGAGAAAAAGG - Intergenic
1187274675 X:17806965-17806987 ATCTCCAGTGTTAGAGGTAGGGG - Intronic
1188923797 X:36012910-36012932 AACTGCTGAGTCAGAGGGAGTGG + Intergenic
1189283263 X:39833967-39833989 AATTCCAGTGTGAGAGAGAGTGG - Intergenic
1189740791 X:44115402-44115424 AAATCTTGTGTCAGAGAGAAAGG - Intergenic
1194804132 X:98306379-98306401 AATTCCTCTATCAGAGATGGTGG - Intergenic
1196391547 X:115212153-115212175 GACTCCCGTGTGAGAGACAGAGG + Intronic
1196897532 X:120352409-120352431 GACTCCTGGGTCAGAGATAAGGG - Intergenic
1197072017 X:122310690-122310712 AACTCCATTGTCAGACAAAGGGG + Intergenic
1198135550 X:133746141-133746163 GACTCCTGAGTCAGAGATGAAGG - Intronic