ID: 1065053053

View in Genome Browser
Species Human (GRCh38)
Location 10:21815514-21815536
Sequence CCAGCAGTATCTATGAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065053051_1065053053 12 Left 1065053051 10:21815479-21815501 CCTCTATCTCTGACACAGGAGTT 0: 1
1: 0
2: 6
3: 34
4: 224
Right 1065053053 10:21815514-21815536 CCAGCAGTATCTATGAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065053053 Original CRISPR CCAGCAGTATCTATGAAACT AGG Intronic
No off target data available for this crispr