ID: 1065054196

View in Genome Browser
Species Human (GRCh38)
Location 10:21827068-21827090
Sequence TCCAATCCATGAACATAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065054194_1065054196 14 Left 1065054194 10:21827031-21827053 CCCTGGGTAGTATTGTCATTTTA 0: 3
1: 6
2: 49
3: 538
4: 10663
Right 1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG No data
1065054195_1065054196 13 Left 1065054195 10:21827032-21827054 CCTGGGTAGTATTGTCATTTTAA 0: 1
1: 0
2: 3
3: 37
4: 417
Right 1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG No data
1065054193_1065054196 27 Left 1065054193 10:21827018-21827040 CCGAATATGATTGCCCTGGGTAG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065054196 Original CRISPR TCCAATCCATGAACATAAGA CGG Intronic
No off target data available for this crispr