ID: 1065069105

View in Genome Browser
Species Human (GRCh38)
Location 10:22003676-22003698
Sequence ACAGCTGTGTGTAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065069105_1065069119 17 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069119 10:22003716-22003738 CCTGGGCTGCACAGTGGGTGAGG 0: 1
1: 0
2: 4
3: 61
4: 480
1065069105_1065069117 12 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069117 10:22003711-22003733 CGGCGCCTGGGCTGCACAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 105
1065069105_1065069113 0 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069113 10:22003699-22003721 AGAGGCAGCGCCCGGCGCCTGGG 0: 1
1: 0
2: 2
3: 19
4: 166
1065069105_1065069111 -8 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069111 10:22003691-22003713 ACAGCTGTAGAGGCAGCGCCCGG 0: 1
1: 0
2: 0
3: 20
4: 342
1065069105_1065069112 -1 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069112 10:22003698-22003720 TAGAGGCAGCGCCCGGCGCCTGG 0: 1
1: 0
2: 2
3: 9
4: 109
1065069105_1065069116 11 Left 1065069105 10:22003676-22003698 CCCCCAGGCCTACACACAGCTGT 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1065069116 10:22003710-22003732 CCGGCGCCTGGGCTGCACAGTGG 0: 1
1: 0
2: 1
3: 22
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065069105 Original CRISPR ACAGCTGTGTGTAGGCCTGG GGG (reversed) Exonic
900537892 1:3187819-3187841 ACAGCTCTGTAAAGGGCTGGGGG - Intronic
904280216 1:29413633-29413655 ACAGCTGAGCGAAGACCTGGTGG - Intergenic
904281718 1:29425261-29425283 CCAGCACTGTGTAGGCCTTGAGG + Intergenic
904578528 1:31522563-31522585 ACAGCTGGGTGGAAGCCTGGAGG - Intergenic
905304707 1:37009572-37009594 ACGGCAGTGTGTATGGCTGGAGG + Intronic
906033099 1:42735651-42735673 GCATCTGTGTGTATGCCTGGGGG + Intronic
907515706 1:54991979-54992001 ATAGCTGGGTGGAGGCCAGGCGG - Exonic
910553350 1:88501315-88501337 ATATATGTGTGAAGGCCTGGAGG + Intergenic
911448619 1:98034515-98034537 ACAGCAGGTTGTATGCCTGGAGG + Intergenic
911969190 1:104408437-104408459 ACTGCTGAGTGTGGGACTGGTGG + Intergenic
912044451 1:105437095-105437117 GCAGCTCTGTGCAGGCCTGCAGG + Intergenic
913971284 1:143420159-143420181 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914065661 1:144245772-144245794 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
914113490 1:144720582-144720604 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
914801979 1:150968631-150968653 TCAGCTGTGGGCAGCCCTGGAGG - Intronic
915079964 1:153345367-153345389 ACATCTGTGGGAAGGCCTTGGGG + Exonic
915141969 1:153773471-153773493 ACAGCAGTGTGAGGGGCTGGAGG - Exonic
917465003 1:175268275-175268297 CCAGCTGTGTGTAGGGGTGGGGG + Intergenic
917985658 1:180315618-180315640 ACAGCTGAATGTAGGGGTGGAGG + Intronic
918039906 1:180907738-180907760 GCAGCTGTCTGCAGGCCAGGAGG - Intergenic
919746249 1:201010793-201010815 ACAGCTCTGAGTGGGCCTTGGGG - Intronic
919772156 1:201169128-201169150 AAAGCTGTGTGTAGGTATAGAGG + Intronic
920495003 1:206448259-206448281 ACAGCTGTGGGGAGGCCATGTGG - Intronic
921069887 1:211649963-211649985 ACAGATCTGGGGAGGCCTGGGGG - Intergenic
921094449 1:211874596-211874618 CCAGATGGGTGTGGGCCTGGCGG - Intergenic
923755237 1:236785731-236785753 ACAGCTGGGTGCTGGCCTGCAGG + Intergenic
924948412 1:248861432-248861454 ACAGCTGGGTGGTGGGCTGGGGG - Intergenic
1062884347 10:1004965-1004987 ACAGCTGTGAGGATGCCAGGGGG + Intronic
1063700093 10:8376103-8376125 ACAGCTGTCAGAAGGCCTGTGGG - Intergenic
1064966624 10:21020993-21021015 ACAGCTGTGTTTTGGACTGGTGG - Intronic
1065069105 10:22003676-22003698 ACAGCTGTGTGTAGGCCTGGGGG - Exonic
1067155339 10:43776609-43776631 CTACCTGTGTCTAGGCCTGGGGG + Intergenic
1067204050 10:44198660-44198682 ACAGCTGTGTGTGGGCAGAGTGG + Intergenic
1069778846 10:70942328-70942350 GCACATGTGTGAAGGCCTGGTGG + Intergenic
1072207515 10:93217427-93217449 ACAGATGTGTGCAGGCATTGAGG - Intergenic
1077310472 11:1886758-1886780 GCAGCTCTATGGAGGCCTGGCGG - Exonic
1079310636 11:19362523-19362545 ACAGGTCTGTGTACTCCTGGTGG - Intronic
1079353854 11:19714323-19714345 GCAGCTGTGTGTCTGTCTGGCGG + Intronic
1080225048 11:29950559-29950581 ACAGCTGTGTGTGGTCATAGTGG - Intergenic
1083920212 11:65778368-65778390 ACAGCTGTATGCACCCCTGGAGG - Exonic
1084122866 11:67079564-67079586 ACTGCTGTTTGCAGGCCTGCAGG + Intergenic
1084657142 11:70526292-70526314 ACAGCTGTGGTTATGGCTGGTGG - Intronic
1084961813 11:72720881-72720903 AAAGCTGAGTGTAGGTCTGGTGG - Intronic
1085729066 11:78981145-78981167 ACAGGTGTGTGTATGCGAGGAGG + Intronic
1090471907 11:126988554-126988576 ACAGGTGGGCATAGGCCTGGAGG + Intronic
1091787863 12:3253810-3253832 TCTGCTGTGCGTGGGCCTGGTGG + Intronic
1093303295 12:17479468-17479490 ACAGCGGTGTGTTGGGCTGTGGG - Intergenic
1094266734 12:28568261-28568283 ACAGCAGTGTGAGTGCCTGGTGG - Intronic
1094487094 12:30933923-30933945 ACTGCTGTGTGTAGGTGTGAAGG - Intronic
1096033500 12:48442518-48442540 ACAGCTGTGTTCAGGGCTGGTGG - Intergenic
1097994239 12:65870441-65870463 ACAGCTGGGGGCAGGCGTGGTGG + Intronic
1098581821 12:72108876-72108898 ACAGCTTTGTGTAGGCCACTGGG + Intronic
1101568552 12:105932507-105932529 ACAGCTCTGAGTAGGCGGGGTGG + Intergenic
1103536600 12:121637750-121637772 CCAGGTGTGGGCAGGCCTGGGGG + Intronic
1104896627 12:132168056-132168078 ACAGCTGAGTGTAGGGGTCGGGG + Intergenic
1105706283 13:22969432-22969454 ACAGCACTGGGCAGGCCTGGAGG - Intergenic
1105858935 13:24392890-24392912 ACAGCACTGGGCAGGCCTGGAGG - Intergenic
1105926938 13:25017429-25017451 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
1106172751 13:27302349-27302371 ACTCCTGTGTGTGTGCCTGGTGG + Intergenic
1106801077 13:33256337-33256359 ACTGCTGACTGTAGGGCTGGAGG - Intronic
1106954943 13:34926667-34926689 ACTGCTCTGTGTAGTCCTTGTGG - Intergenic
1109838821 13:67894903-67894925 ACAGCTGTGTGTAAGACCAGTGG + Intergenic
1110058592 13:71011469-71011491 ACATCTGAATGTAGGCCAGGTGG - Intergenic
1110462438 13:75759938-75759960 ACAGATGTGTGTTGGCATGCTGG + Intronic
1110555488 13:76854964-76854986 ACAGCTTTGTTTAGTCCTAGTGG + Intergenic
1111916361 13:94364760-94364782 GCAGCTGTGTGTGGGGGTGGGGG + Intronic
1113014709 13:105815687-105815709 AGAGCTGGGTGTAGGCCTACGGG + Intergenic
1113535589 13:111063970-111063992 ACTGCTGTGTGTGGGCTTCGTGG - Intergenic
1113870582 13:113557346-113557368 ACAGGTGTGTGTAGATGTGGGGG + Intergenic
1113958928 13:114114938-114114960 ACAGCTGGGGGTGGGGCTGGGGG - Intronic
1114071934 14:19118022-19118044 ACTGCTCTGTGTAGTCCTTGCGG - Intergenic
1114090324 14:19281942-19281964 ACTGCTCTGTGTAGTCCTTGCGG + Intergenic
1119483837 14:74975737-74975759 GCAGCTGTGTGTATGTGTGGTGG - Intergenic
1121010806 14:90519031-90519053 ACAGGGGTGTGAACGCCTGGCGG - Intergenic
1121210266 14:92203140-92203162 ACAGCTGGGTGTGGTCCTGCTGG + Intergenic
1122078217 14:99249045-99249067 ACAGATGTGTGCAGGACAGGTGG + Intronic
1122406134 14:101502167-101502189 ACAGCAGTGTGCAGCCATGGAGG + Intergenic
1122569283 14:102683789-102683811 CCAGCTGTGGGAAGGGCTGGTGG - Intronic
1122723464 14:103735312-103735334 GCAGCTGAGCGTAGGCCTGAGGG - Intronic
1122783913 14:104155257-104155279 ACAGATGCGTTTGGGCCTGGAGG + Intronic
1123983456 15:25623818-25623840 AGAGCTGGGTGGAGGCCAGGGGG - Intergenic
1124497548 15:30195807-30195829 GGAGCTGTGTGGCGGCCTGGGGG - Intergenic
1124746041 15:32342884-32342906 GGAGCTGTGTGGCGGCCTGGGGG + Intergenic
1124973789 15:34514944-34514966 GGAGCTGTGTGGCGGCCTGGGGG + Intergenic
1126572439 15:50166573-50166595 TCAGCTGTGTGCATTCCTGGAGG - Intronic
1126689291 15:51275372-51275394 AAAGCTCTGAGTAGGGCTGGAGG - Intronic
1129515925 15:76157544-76157566 ACAGTGGGGGGTAGGCCTGGTGG - Intronic
1129869235 15:78930142-78930164 CCCGCTGTGTGTAGGCCCTGGGG - Intronic
1130936050 15:88471452-88471474 ATATATGTGTGTAGGCCTAGAGG + Intronic
1132291902 15:100709802-100709824 ACAGCTGTGTCTAGGCCAGATGG + Intergenic
1132658546 16:1051539-1051561 ACAGAAGTGGGTGGGCCTGGTGG - Intergenic
1136106712 16:28035296-28035318 ACAGCTGAGGATAGGCGTGGTGG - Intronic
1138431083 16:56969659-56969681 TCAGCTGTGTGTTGATCTGGAGG - Exonic
1141042366 16:80683300-80683322 ACACCTGTGTGTCTACCTGGTGG - Intronic
1141166683 16:81665509-81665531 GCAGCTGTGGGTGGTCCTGGTGG + Intronic
1141777730 16:86135399-86135421 ACAAATCTGTGCAGGCCTGGTGG + Intergenic
1141780752 16:86159086-86159108 ACAGGTGTGTGAAGACCTGTGGG + Intergenic
1141916304 16:87099497-87099519 AATGCTGTTTGTAGCCCTGGAGG - Intronic
1142223484 16:88866326-88866348 ACAGCTGTGTGGAGGCCCTGGGG - Intronic
1143000997 17:3794966-3794988 GCCGCTGTGTCGAGGCCTGGAGG - Intronic
1143266058 17:5638950-5638972 GCAGCTGTCTCTAGGCCTGGTGG + Intergenic
1144045060 17:11447903-11447925 ACAGCAGTGGGCAGGGCTGGAGG + Intronic
1144666274 17:17104524-17104546 ACGGCTGTGTTCAAGCCTGGTGG + Intronic
1146359125 17:32159764-32159786 GCAGCTTGGTGTAGGCCTGCAGG + Intronic
1146425273 17:32732145-32732167 GCAGCTTGGTGTGGGCCTGGAGG + Intronic
1147262912 17:39219073-39219095 ACAGCTGTATGGAGGACAGGTGG - Intronic
1147432127 17:40378253-40378275 ACAGCTGGGTGTAGGCGTGGTGG + Intergenic
1147948011 17:44091477-44091499 ACAGCTTCGGGGAGGCCTGGGGG + Exonic
1149443713 17:56697537-56697559 GCAGCTGTCTGCAGGCCAGGTGG - Intergenic
1149527477 17:57367855-57367877 ACAGCTGTGTGGCATCCTGGAGG + Intronic
1149825883 17:59827674-59827696 ACAGGTGTGAGTGGGCCTGGTGG - Intronic
1151480819 17:74369255-74369277 ACAGGTATGTCTATGCCTGGGGG - Intronic
1151530733 17:74703201-74703223 AGAGCTGTGTGCAGGGCTGCGGG - Intronic
1152316365 17:79582975-79582997 ACATCTGTGGGAAGCCCTGGCGG - Intergenic
1152410236 17:80119402-80119424 GCAGCTGTGTGCGGGCCTGGGGG + Intergenic
1152423312 17:80205476-80205498 CCAGCTGTGTGGGGGTCTGGGGG - Intronic
1152572411 17:81126641-81126663 TCAGCTGTGGGTAGGGGTGGAGG - Intronic
1152666677 17:81574410-81574432 ACATCTGAGTGAAGGCTTGGGGG - Intronic
1153004435 18:484826-484848 ACATCTGGGAGTGGGCCTGGGGG - Intronic
1156628123 18:38934287-38934309 AGAGCAGTGAGAAGGCCTGGAGG + Intergenic
1159895428 18:73991521-73991543 ACAGGTTGGTGGAGGCCTGGAGG - Intergenic
1160802613 19:977275-977297 ACAGCTGTGTGAAGGCCCTGAGG - Intergenic
1161768866 19:6220830-6220852 CCAGCTGTGGGAGGGCCTGGCGG - Intronic
1162580640 19:11528158-11528180 ACAGCTGTGGGCAGATCTGGAGG - Intronic
1163822939 19:19506479-19506501 ACAGGTGTGTGCAGGTCAGGAGG + Exonic
1164757775 19:30703087-30703109 GCAGCTGCATGGAGGCCTGGAGG + Intronic
1165312760 19:35038959-35038981 CCAGCCTTGGGTAGGCCTGGTGG - Intronic
1167116959 19:47493953-47493975 ACAGATAGGTGTTGGCCTGGGGG - Intronic
925169204 2:1740645-1740667 CCAGGTGTGTGCAGTCCTGGTGG - Intronic
927717764 2:25363642-25363664 ACAAGTGTGTGTATACCTGGTGG + Intergenic
927995277 2:27481076-27481098 ACAGCTGTATCAAGTCCTGGGGG - Exonic
928797031 2:35034799-35034821 GCAGCTTGGTGTAGGCCTGCTGG - Intergenic
928906824 2:36377102-36377124 ACACCTGTGTGCAGGGCTGGGGG - Intronic
928979993 2:37127627-37127649 ACAGTTGTGGGGAGGCCTGATGG - Intronic
933254019 2:80060245-80060267 AGAGCTGAGTCAAGGCCTGGAGG + Intronic
934175979 2:89581092-89581114 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
934286289 2:91655454-91655476 GCAGCTCTATGGAGGCCTGGCGG + Intergenic
937354434 2:121189199-121189221 ACTGCTCTGTGGAGGGCTGGTGG - Intergenic
939993557 2:148899412-148899434 ACAGCTGGGTCCAGGCGTGGTGG + Intronic
941852711 2:170200263-170200285 ACAGCTGTGGCTGGTCCTGGAGG + Exonic
944048588 2:195440523-195440545 ATTGCTGTCTGGAGGCCTGGAGG + Intergenic
944559138 2:200917559-200917581 ACAGCTGAGTGTATACATGGAGG + Intronic
945967736 2:216207081-216207103 TCTGCTGAGTGTAGCCCTGGAGG + Intergenic
948894369 2:240921426-240921448 ACAGCTGTGGGGAGGCCTTGGGG + Intronic
949054033 2:241914927-241914949 ACAGCAGTGAGCAGTCCTGGGGG + Intergenic
1170410210 20:16081708-16081730 ATAGCTGTGTGAATTCCTGGTGG - Intergenic
1170917510 20:20642023-20642045 ACAGGTGTGAGTGGGCATGGAGG - Intronic
1171125256 20:22596981-22597003 CCAGCTGTGTGAACTCCTGGAGG - Intergenic
1171359491 20:24577153-24577175 ACAGCTGTATGGAGATCTGGGGG - Intronic
1172101678 20:32487489-32487511 ACAGCTGGGTGAAGACCTGGGGG + Intronic
1172899003 20:38320525-38320547 AGAGCTGTGTGGAAACCTGGGGG - Intronic
1173024539 20:39295729-39295751 ACAGCTTTGGGTGGGCATGGTGG + Intergenic
1173383657 20:42568682-42568704 ACAGCTCTCTGTAGGCCAGGAGG - Intronic
1175903808 20:62370231-62370253 GCAGCTGAGTGTGGGCGTGGGGG - Intergenic
1176200859 20:63859723-63859745 TCAACTGTGTGTGTGCCTGGGGG + Intergenic
1176247736 20:64105390-64105412 ACGGCTGTCTGTAGGTCTGGTGG + Intergenic
1176251079 20:64120253-64120275 TCAGCTGTGAGTAGGACGGGAGG + Intergenic
1178958103 21:37041547-37041569 ACAGCTGTGTATTAGCCTGAGGG + Intergenic
1180967079 22:19796013-19796035 AGAGATGTGTCTACGCCTGGAGG + Intronic
1181468554 22:23123937-23123959 GCAGCTGTGTGCAGGCCAGCAGG - Exonic
1184521094 22:44994655-44994677 TCAGCTGTGTGTGAGCCCGGGGG - Intronic
1185160003 22:49218640-49218662 ACAGTTGTGTGGAAGCCGGGAGG + Intergenic
1185343344 22:50301060-50301082 ACAACTGTGTGTAGGATGGGAGG - Intronic
949891749 3:8738368-8738390 ACAAGTGTTTGTAGGGCTGGTGG - Intronic
950141897 3:10621321-10621343 ACTGCTCTGTGTTGGCCTCGTGG - Intronic
950182898 3:10927556-10927578 ACTGCAGTGTGTAGGCCAAGAGG - Intronic
950457066 3:13099165-13099187 ACCACTGAGTGTAGCCCTGGGGG + Intergenic
950480050 3:13238435-13238457 ACAGCTGAGTAGAGGCCTGGAGG - Intergenic
951253897 3:20426989-20427011 TCAGCTGTTTGTAGGTGTGGTGG + Intergenic
953747343 3:45585312-45585334 ACTGCTGAGTGGAGACCTGGGGG + Intronic
953922044 3:46958848-46958870 TCAGCTGTGTGTTGGCATGGAGG - Intronic
954760720 3:52871664-52871686 ACAGCTGTGTGGAGGATGGGTGG - Intronic
954841620 3:53516488-53516510 AGCGCTGTGTGGAAGCCTGGTGG + Intronic
955334158 3:58071239-58071261 ATAGGGGTGTGTAGGCCAGGCGG - Intronic
957048606 3:75395214-75395236 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
958571031 3:95883352-95883374 AAAGCTGAGTGTGGGCCTGAGGG + Intergenic
959252500 3:103966050-103966072 ACAGCTCAGTGTGGGCCTGCAGG + Intergenic
959897052 3:111617149-111617171 GCAGCTGGGTGCAGGCCTGCAGG + Intronic
961412866 3:126735527-126735549 CCTGCTGTGTGTAGACTTGGTGG + Intronic
964767431 3:160192378-160192400 ACAGCTGTGGGCAGGCCAGTAGG - Intergenic
965493901 3:169374225-169374247 ACAGCTGTCTGCAAGCATGGAGG + Intronic
968544736 4:1193011-1193033 ACATATGTGTGTGGGCCTGGTGG - Intronic
968964291 4:3761713-3761735 AGAGCTGAATGAAGGCCTGGTGG - Intergenic
969612708 4:8236152-8236174 ACAGCTGTGTCGAGGCCCAGGGG + Intronic
969719029 4:8882965-8882987 ATGGCTGTGTGTAGGCAGGGTGG + Intergenic
970451386 4:16169622-16169644 AGAGCTGTGTGTAGGTCATGTGG - Intronic
971159767 4:24121644-24121666 ATAGCTGTGTATGGGCCTCGTGG - Intergenic
974078807 4:57192380-57192402 ACAGCAGTGTGTAGGCCTCTAGG + Intergenic
975496855 4:75045127-75045149 TGAGCTGTGTGGAGACCTGGAGG + Intronic
976413817 4:84748038-84748060 ACAGATTTGTGTATACCTGGAGG - Intronic
978030443 4:103935415-103935437 ACAGTTTTGTATATGCCTGGAGG - Intergenic
981352821 4:143752387-143752409 ACAGCGGTGTGTAGGGCTATGGG - Intergenic
983547591 4:168979500-168979522 GCAGCTCTGTGTTTGCCTGGTGG + Intronic
985481017 5:110975-110997 CCAGCTGTGTCCAGGCCTCGGGG - Intergenic
985878224 5:2617309-2617331 ACAACTGTGTGTTGGACTGCTGG - Intergenic
986700034 5:10397753-10397775 AGAGCTGAGTGTAGGCTTGTGGG + Intronic
987261595 5:16209923-16209945 ACAGTTGCGTGTAGGCCGGCTGG + Intergenic
988263888 5:28926842-28926864 GCAGCTCTATGGAGGCCTGGCGG - Intergenic
991504392 5:67308923-67308945 CCAGCTGTGTGTGGCCCTGGAGG - Intergenic
993253427 5:85556736-85556758 ACAGCTGGGTGTTGGGCTGTGGG - Intergenic
995513542 5:112931462-112931484 TCACATCTGTGTAGGCCTGGAGG - Intergenic
995518293 5:112975976-112975998 GCAGGTGTGTGTGGGCCTGTGGG + Intergenic
996354890 5:122584879-122584901 ACATCTGTGTTTAGTCCTGAGGG + Intergenic
997954034 5:138264493-138264515 ACAGCTGTCTCCAGGCCAGGAGG - Exonic
999197174 5:149790328-149790350 CTAGCTGTGTGGAAGCCTGGTGG + Intronic
999884030 5:155900379-155900401 AAAACTGTGTGTAGGGTTGGGGG - Intronic
999924108 5:156356382-156356404 AGAGCTGTGTGTAGGCGTTCTGG - Intronic
1001233349 5:170008939-170008961 ACAGCTGCTTGCAGGGCTGGGGG - Intronic
1001249751 5:170137941-170137963 AAGGCGGTGGGTAGGCCTGGGGG + Intergenic
1001269738 5:170302301-170302323 ACTTCTGTGTGTGGGGCTGGGGG + Intergenic
1001269897 5:170303107-170303129 AGAGCTGTGTCCAGGCCTGGGGG - Intergenic
1001483234 5:172102595-172102617 AAGGGTGTGTGGAGGCCTGGAGG + Intronic
1002171566 5:177377653-177377675 ACAACAGTGTGTGGGCCAGGCGG - Intergenic
1002175812 5:177400472-177400494 ACAGCTGCGTGTGGGCTTCGCGG - Exonic
1005659225 6:27977563-27977585 CCAGCTGTGTCTAGGACTGATGG + Intergenic
1008448369 6:51619858-51619880 ACAGGTGTGAGTTGGCCTGTTGG - Intronic
1009276759 6:61691936-61691958 ACAGCTGTGTGGAAGCAAGGAGG - Intronic
1012951908 6:105527185-105527207 ACAGCCTTGTCTAGCCCTGGGGG - Intergenic
1018099584 6:160424912-160424934 AGAGAAGTGTGTAAGCCTGGTGG - Intronic
1019492350 7:1321376-1321398 ACAGCTTTGCCTAGGGCTGGTGG + Intergenic
1019564345 7:1672022-1672044 ACAGCTGGCTGTAGGACAGGGGG - Intergenic
1019621801 7:1996158-1996180 GCAGCCGTGTGTAGACCCGGGGG - Intronic
1019621845 7:1996272-1996294 GCAGCCGTGTGTAGACCCGGGGG - Intronic
1019621859 7:1996310-1996332 GCAGCCGTGTGTAGACCCGGGGG - Intronic
1020649209 7:10854863-10854885 ACAGCTGGGTGCTGGCCTGCAGG + Intergenic
1022882744 7:34605819-34605841 GCAGCTGTGTGTAGAGATGGGGG + Intergenic
1023695644 7:42843463-42843485 ACAGCTGTCTTTAGGACTGAGGG - Intergenic
1023859554 7:44209640-44209662 TCAGCTGTGTGTAGGGATGAAGG + Intronic
1024053700 7:45646191-45646213 AGAGCTGACTGTGGGCCTGGAGG + Intronic
1024557726 7:50617775-50617797 ACTGCTGAGTGTGGGCCAGGGGG - Intronic
1026794793 7:73359325-73359347 ACAGCTGTGGGTACTCATGGAGG - Intergenic
1029217208 7:98959189-98959211 CCAGCTGTGTGGAGGTCAGGCGG + Intronic
1032552461 7:132797189-132797211 TCAGCTGTGTGCAGGGTTGGGGG - Intronic
1035663577 8:1364392-1364414 CCTGCTGTGGGCAGGCCTGGGGG + Intergenic
1036078784 8:5529751-5529773 ACATCTGTGTACAGACCTGGAGG + Intergenic
1036562674 8:9910217-9910239 ATAGCTGTGTCTTGGGCTGGGGG - Intergenic
1037051980 8:14385088-14385110 ACAACTGTGTGTAGGAATTGGGG + Intronic
1038306895 8:26413188-26413210 AAGGCTGTGTGTAGGCGAGGAGG - Intronic
1038763381 8:30405388-30405410 ACACATGTGTGTAGGCTTTGTGG - Intronic
1039988572 8:42468435-42468457 ACAGCTGAGGGAGGGCCTGGTGG + Intronic
1043204513 8:77420361-77420383 AGAGTTGTGTGTAGGTCTGTAGG + Intergenic
1043370287 8:79583647-79583669 ACAGCAGCCTGGAGGCCTGGAGG + Intergenic
1044447820 8:92299086-92299108 ACAGCTTTATTTAGGACTGGAGG - Intergenic
1044717209 8:95111626-95111648 GCAGGTGTGTGTGTGCCTGGAGG - Intronic
1045097996 8:98818069-98818091 AAAGCTATGAGAAGGCCTGGAGG - Intronic
1048720764 8:137321779-137321801 AGAGCAGTGTGGAGGACTGGGGG + Intergenic
1049209174 8:141377402-141377424 ACACCTGTGTGTGGGACAGGTGG + Intergenic
1049409959 8:142468633-142468655 ACAGCTGTGTGAAGGCCCTGAGG - Intronic
1049593703 8:143473939-143473961 ACAGCTGTGTGTAGCCCCACAGG + Intronic
1051591631 9:18781752-18781774 TCAGCTGTGTGTTGGTCTGTGGG + Intronic
1052863028 9:33448262-33448284 ACAGCTGTGTCTACACATGGCGG + Intergenic
1052976597 9:34415439-34415461 ACAGTTGTTACTAGGCCTGGGGG - Intronic
1053715380 9:40883646-40883668 GCAGCTCTATGGAGGCCTGGTGG - Intergenic
1053758416 9:41332784-41332806 CCAGCTGTGTGAGGCCCTGGGGG + Intergenic
1054077167 9:60547088-60547110 GCAGCTCTATGGAGGCCTGGTGG + Intergenic
1057833000 9:98420795-98420817 TCACCTGTGTAAAGGCCTGGAGG + Intronic
1058339531 9:103877741-103877763 GCAGCTGTCTGTAAGCCAGGAGG - Intergenic
1058456946 9:105146689-105146711 AGAGCTGTGTGTTGACCTGTTGG - Intergenic
1059366940 9:113793690-113793712 GCAGCTGAGTGTAGGCCTCCTGG - Intergenic
1059830639 9:118091503-118091525 TCATGTGTGTGTATGCCTGGTGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060725639 9:126003888-126003910 ACAGCAGTGTGAAGGCCTGAAGG + Intergenic
1061012532 9:127963990-127964012 TCAGCTGGGTGAAGACCTGGGGG + Intronic
1061862518 9:133475330-133475352 TCAGCTGTGTGTGGCCGTGGAGG - Intronic
1062086967 9:134653989-134654011 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062086975 9:134654036-134654058 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087019 9:134654211-134654233 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087064 9:134654401-134654423 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087075 9:134654448-134654470 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087083 9:134654495-134654517 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087201 9:134654968-134654990 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087214 9:134655015-134655037 GCTGGTGTGTGTAGGGCTGGGGG + Intronic
1062087221 9:134655046-134655068 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1062087235 9:134655093-134655115 GCTGGTGTGTGTAGGGCTGGGGG + Intronic
1062087242 9:134655124-134655146 GCTGGTGTGTGTAGGGCTGGAGG + Intronic
1185691629 X:2159971-2159993 ACTGCTGTGTGTAGACTGGGCGG - Intergenic
1186223693 X:7375501-7375523 GCAGCTCTGTGTGGGCCTGCAGG - Intergenic
1186853768 X:13606205-13606227 AGAGCTGTGTGTGTGCCTGGGGG + Intronic
1188663493 X:32790402-32790424 ACAGCTGTGTGTTGGTTTGGGGG - Intronic
1189015963 X:37096627-37096649 ACACATGTGTGTAGGCTTTGTGG - Intergenic
1189224849 X:39403924-39403946 ACAGATGTGTGTGGGAGTGGGGG - Intergenic
1190715046 X:53096053-53096075 ACAGCTGAGTAGAGGCCTGAAGG - Intergenic
1192450738 X:71243230-71243252 AGAGCTGTGGGTATACCTGGGGG - Intronic
1196421683 X:115528718-115528740 ACCGCTGTGTGCAGGGGTGGGGG + Intergenic
1199425213 X:147693143-147693165 ACAGCAGTGGGTAGGCATGGAGG - Intergenic
1199991151 X:152988394-152988416 AGAGCTGTGTGCAGGACTCGGGG - Intergenic
1200206176 X:154317888-154317910 GGAGCTCTGTGTGGGCCTGGGGG + Intronic
1202345922 Y:23926872-23926894 ACAGATGTGTGTATGTGTGGGGG + Intergenic
1202524849 Y:25743218-25743240 ACAGATGTGTGTATGTGTGGGGG - Intergenic