ID: 1065077908

View in Genome Browser
Species Human (GRCh38)
Location 10:22099226-22099248
Sequence TTTGAGGGCCAGAAGCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065077902_1065077908 11 Left 1065077902 10:22099192-22099214 CCTTCCATCTGTAAGCTGGAAAC No data
Right 1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG No data
1065077900_1065077908 17 Left 1065077900 10:22099186-22099208 CCACAACCTTCCATCTGTAAGCT No data
Right 1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG No data
1065077898_1065077908 19 Left 1065077898 10:22099184-22099206 CCCCACAACCTTCCATCTGTAAG No data
Right 1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG No data
1065077903_1065077908 7 Left 1065077903 10:22099196-22099218 CCATCTGTAAGCTGGAAACCAGT No data
Right 1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG No data
1065077899_1065077908 18 Left 1065077899 10:22099185-22099207 CCCACAACCTTCCATCTGTAAGC No data
Right 1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065077908 Original CRISPR TTTGAGGGCCAGAAGCATCA AGG Intergenic
No off target data available for this crispr