ID: 1065078472

View in Genome Browser
Species Human (GRCh38)
Location 10:22104127-22104149
Sequence GCATTCTGGTGTGCTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065078472_1065078475 6 Left 1065078472 10:22104127-22104149 CCAATAGCAGCACACCAGAATGC No data
Right 1065078475 10:22104156-22104178 AAAGGATACATAAAGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065078472 Original CRISPR GCATTCTGGTGTGCTGCTAT TGG (reversed) Intergenic
No off target data available for this crispr