ID: 1065085447

View in Genome Browser
Species Human (GRCh38)
Location 10:22170223-22170245
Sequence ATCTTTAGCTAGAATGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065085446_1065085447 5 Left 1065085446 10:22170195-22170217 CCTCTAAAAAGATCAACAAAAGT No data
Right 1065085447 10:22170223-22170245 ATCTTTAGCTAGAATGACTAAGG No data
1065085445_1065085447 15 Left 1065085445 10:22170185-22170207 CCAAAAGATGCCTCTAAAAAGAT No data
Right 1065085447 10:22170223-22170245 ATCTTTAGCTAGAATGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065085447 Original CRISPR ATCTTTAGCTAGAATGACTA AGG Intergenic
No off target data available for this crispr