ID: 1065086540

View in Genome Browser
Species Human (GRCh38)
Location 10:22184367-22184389
Sequence CAGTGTTAGAAGTGGCAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065086533_1065086540 8 Left 1065086533 10:22184336-22184358 CCTTCCAGTCTCAATGAGTTGTT No data
Right 1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG No data
1065086535_1065086540 4 Left 1065086535 10:22184340-22184362 CCAGTCTCAATGAGTTGTTGGCC No data
Right 1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065086540 Original CRISPR CAGTGTTAGAAGTGGCAATA AGG Intergenic
No off target data available for this crispr