ID: 1065092373

View in Genome Browser
Species Human (GRCh38)
Location 10:22247711-22247733
Sequence ATACCAAGTGATTCTCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065092373_1065092377 30 Left 1065092373 10:22247711-22247733 CCACCACGAGAATCACTTGGTAT No data
Right 1065092377 10:22247764-22247786 TAAGCAAAACAATAACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065092373 Original CRISPR ATACCAAGTGATTCTCGTGG TGG (reversed) Intergenic