ID: 1065093182

View in Genome Browser
Species Human (GRCh38)
Location 10:22253772-22253794
Sequence AAGCCGAGCCGCGGGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065093182_1065093189 24 Left 1065093182 10:22253772-22253794 CCTGCCCACCCGCGGCTCGGCTT No data
Right 1065093189 10:22253819-22253841 ATCACCATTGCAGGATAAGCTGG No data
1065093182_1065093188 15 Left 1065093182 10:22253772-22253794 CCTGCCCACCCGCGGCTCGGCTT No data
Right 1065093188 10:22253810-22253832 GACTATTCTATCACCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065093182 Original CRISPR AAGCCGAGCCGCGGGTGGGC AGG (reversed) Intergenic