ID: 1065093453

View in Genome Browser
Species Human (GRCh38)
Location 10:22258667-22258689
Sequence CTGAGGGGCAGGTGGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065093453_1065093461 8 Left 1065093453 10:22258667-22258689 CCATCTGACCACCTGCCCCTCAG No data
Right 1065093461 10:22258698-22258720 GGGACTTGTCCTCTGTTGACAGG No data
1065093453_1065093462 9 Left 1065093453 10:22258667-22258689 CCATCTGACCACCTGCCCCTCAG No data
Right 1065093462 10:22258699-22258721 GGACTTGTCCTCTGTTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065093453 Original CRISPR CTGAGGGGCAGGTGGTCAGA TGG (reversed) Intergenic
No off target data available for this crispr