ID: 1065095042

View in Genome Browser
Species Human (GRCh38)
Location 10:22272083-22272105
Sequence ATGCTCTTTTTATTGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065095035_1065095042 26 Left 1065095035 10:22272034-22272056 CCAGAAGATGAGGGTTACAGGGA No data
Right 1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG No data
1065095037_1065095042 2 Left 1065095037 10:22272058-22272080 CCATCCTAGAGGTTGCCTACCAC No data
Right 1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG No data
1065095038_1065095042 -2 Left 1065095038 10:22272062-22272084 CCTAGAGGTTGCCTACCACACAT No data
Right 1065095042 10:22272083-22272105 ATGCTCTTTTTATTGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065095042 Original CRISPR ATGCTCTTTTTATTGAAACA GGG Intergenic
No off target data available for this crispr