ID: 1065095604

View in Genome Browser
Species Human (GRCh38)
Location 10:22277947-22277969
Sequence CCTGCTAAGGAGCTATACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065095604_1065095608 13 Left 1065095604 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG No data
Right 1065095608 10:22277983-22278005 GTAAAATAACAGAGTTACTCAGG No data
1065095604_1065095611 26 Left 1065095604 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG No data
Right 1065095611 10:22277996-22278018 GTTACTCAGGTGGGATAGCATGG No data
1065095604_1065095610 17 Left 1065095604 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG No data
Right 1065095610 10:22277987-22278009 AATAACAGAGTTACTCAGGTGGG No data
1065095604_1065095609 16 Left 1065095604 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG No data
Right 1065095609 10:22277986-22278008 AAATAACAGAGTTACTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065095604 Original CRISPR CCTGCTAAGGAGCTATACCA AGG (reversed) Intergenic
No off target data available for this crispr