ID: 1065095608

View in Genome Browser
Species Human (GRCh38)
Location 10:22277983-22278005
Sequence GTAAAATAACAGAGTTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065095604_1065095608 13 Left 1065095604 10:22277947-22277969 CCTTGGTATAGCTCCTTAGCAGG No data
Right 1065095608 10:22277983-22278005 GTAAAATAACAGAGTTACTCAGG No data
1065095607_1065095608 0 Left 1065095607 10:22277960-22277982 CCTTAGCAGGAATATTCTGGCTA No data
Right 1065095608 10:22277983-22278005 GTAAAATAACAGAGTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065095608 Original CRISPR GTAAAATAACAGAGTTACTC AGG Intergenic
No off target data available for this crispr