ID: 1065095611 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:22277996-22278018 |
Sequence | GTTACTCAGGTGGGATAGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065095604_1065095611 | 26 | Left | 1065095604 | 10:22277947-22277969 | CCTTGGTATAGCTCCTTAGCAGG | No data | ||
Right | 1065095611 | 10:22277996-22278018 | GTTACTCAGGTGGGATAGCATGG | No data | ||||
1065095607_1065095611 | 13 | Left | 1065095607 | 10:22277960-22277982 | CCTTAGCAGGAATATTCTGGCTA | No data | ||
Right | 1065095611 | 10:22277996-22278018 | GTTACTCAGGTGGGATAGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065095611 | Original CRISPR | GTTACTCAGGTGGGATAGCA TGG | Intergenic | ||
No off target data available for this crispr |