ID: 1065097645

View in Genome Browser
Species Human (GRCh38)
Location 10:22297436-22297458
Sequence CTTTGGAAGGCAAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065097638_1065097645 3 Left 1065097638 10:22297410-22297432 CCAGGCGCAGGTGGGTAATCCCA No data
Right 1065097645 10:22297436-22297458 CTTTGGAAGGCAAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065097645 Original CRISPR CTTTGGAAGGCAAAGGTGGA AGG Intergenic
No off target data available for this crispr