ID: 1065100520

View in Genome Browser
Species Human (GRCh38)
Location 10:22326122-22326144
Sequence CTGCTGGGCTGGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065100511_1065100520 14 Left 1065100511 10:22326085-22326107 CCGCGGGGATTGTGTGGCGTCTG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065100520 Original CRISPR CTGCTGGGCTGGAGGACAAA TGG Intronic
No off target data available for this crispr