ID: 1065101360

View in Genome Browser
Species Human (GRCh38)
Location 10:22335629-22335651
Sequence CCGTCCACCCGGAGCGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065101360_1065101367 -10 Left 1065101360 10:22335629-22335651 CCCTCGGCGCTCCGGGTGGACGG No data
Right 1065101367 10:22335642-22335664 GGGTGGACGGCTCCGGGGCGCGG No data
1065101360_1065101371 6 Left 1065101360 10:22335629-22335651 CCCTCGGCGCTCCGGGTGGACGG No data
Right 1065101371 10:22335658-22335680 GGCGCGGCTCGTCCCTCGGGTGG No data
1065101360_1065101369 2 Left 1065101360 10:22335629-22335651 CCCTCGGCGCTCCGGGTGGACGG No data
Right 1065101369 10:22335654-22335676 CCGGGGCGCGGCTCGTCCCTCGG No data
1065101360_1065101370 3 Left 1065101360 10:22335629-22335651 CCCTCGGCGCTCCGGGTGGACGG No data
Right 1065101370 10:22335655-22335677 CGGGGCGCGGCTCGTCCCTCGGG No data
1065101360_1065101374 20 Left 1065101360 10:22335629-22335651 CCCTCGGCGCTCCGGGTGGACGG No data
Right 1065101374 10:22335672-22335694 CTCGGGTGGTGCAGCCCCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065101360 Original CRISPR CCGTCCACCCGGAGCGCCGA GGG (reversed) Intergenic
No off target data available for this crispr