ID: 1065101953

View in Genome Browser
Species Human (GRCh38)
Location 10:22340542-22340564
Sequence AAGAGCGCCCTGGCCGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065101953_1065101959 3 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101959 10:22340568-22340590 CGTCCCGCGCGCGGACAGCCGGG 0: 1
1: 0
2: 0
3: 6
4: 62
1065101953_1065101957 -6 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101957 10:22340559-22340581 GCTCTTCTACGTCCCGCGCGCGG 0: 1
1: 0
2: 0
3: 1
4: 16
1065101953_1065101965 21 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101965 10:22340586-22340608 CCGGGGCGAAGTAGGCCGACCGG 0: 1
1: 0
2: 1
3: 4
4: 30
1065101953_1065101960 4 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101960 10:22340569-22340591 GTCCCGCGCGCGGACAGCCGGGG 0: 1
1: 0
2: 0
3: 4
4: 44
1065101953_1065101966 26 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101966 10:22340591-22340613 GCGAAGTAGGCCGACCGGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 19
1065101953_1065101958 2 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101958 10:22340567-22340589 ACGTCCCGCGCGCGGACAGCCGG 0: 1
1: 0
2: 1
3: 3
4: 35
1065101953_1065101963 13 Left 1065101953 10:22340542-22340564 CCTTTCCCGGCCAGGGCGCTCTT 0: 1
1: 0
2: 2
3: 17
4: 201
Right 1065101963 10:22340578-22340600 GCGGACAGCCGGGGCGAAGTAGG 0: 1
1: 0
2: 0
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065101953 Original CRISPR AAGAGCGCCCTGGCCGGGAA AGG (reversed) Intergenic