ID: 1065104240

View in Genome Browser
Species Human (GRCh38)
Location 10:22365100-22365122
Sequence CTGTAGGCATAAAATTATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065104240 Original CRISPR CTGTAGGCATAAAATTATTA GGG Intronic
902356882 1:15909560-15909582 CTTTGGGCATAAAATTATAATGG + Intronic
903104731 1:21066579-21066601 CTGTAGGCAAGAAATTGTGAAGG - Intronic
904240401 1:29140800-29140822 GTGCAGGCAGAAAATTAGTAAGG - Intergenic
906900156 1:49826809-49826831 CTGTAAGCATAAACTTCTTGAGG - Intronic
908296045 1:62714201-62714223 CTGTAAGCATAAAATTACACTGG + Intergenic
909245894 1:73283874-73283896 CAGTAGGCAGAAAATTAGTAAGG - Intergenic
909943901 1:81641259-81641281 CAGTAGGCAGAAAATCAGTAGGG + Intronic
910325821 1:86005605-86005627 TTTTATTCATAAAATTATTAAGG - Intronic
911591638 1:99754539-99754561 CAGAAGGCAGAAAATCATTAAGG + Intronic
911809402 1:102254962-102254984 CAGTAGGCAGAAAATTAGTAAGG + Intergenic
912141496 1:106734914-106734936 CTTTTGGCATAAAATTAGAATGG - Intergenic
912592852 1:110844258-110844280 CTGCAGACAGAAAATTATGAAGG - Intergenic
914946881 1:152074885-152074907 CAGTGGGCATAAAAAAATTAAGG + Intergenic
917416858 1:174819487-174819509 CTGTAAGTATACATTTATTAAGG - Intronic
917736835 1:177929174-177929196 CTGTAGGCATCATATTGTCATGG - Exonic
918485528 1:185025069-185025091 CAGCAGGCAGAAAATTAGTAAGG + Intergenic
921622639 1:217343023-217343045 CTGAAGTCACAAAATTATAAGGG - Intergenic
921674125 1:217958838-217958860 CAGCAGGCAGAAAATTAGTAAGG + Intergenic
922075321 1:222237932-222237954 CTCTGAGCATAAAATTATAATGG - Intergenic
923612454 1:235506809-235506831 CTTTAGTCATGAGATTATTAGGG - Intergenic
924254449 1:242168959-242168981 TTGTGGGCATAAATTTATTAGGG - Intronic
1063912294 10:10843711-10843733 ATGTAGGCATAAAATCGATAAGG - Intergenic
1064848713 10:19686022-19686044 CTGTAGGCAGTGAATTCTTATGG + Intronic
1065104240 10:22365100-22365122 CTGTAGGCATAAAATTATTAGGG + Intronic
1065172336 10:23043960-23043982 CTGTAGACAAAAGATTAGTAGGG - Intergenic
1068474222 10:57505458-57505480 CTTTAAGCATATAATTAATATGG + Intergenic
1069000552 10:63258938-63258960 CTGTAGGACAAAAATAATTACGG + Intronic
1071536586 10:86437846-86437868 CAGTAGACATAAAAATACTATGG - Intronic
1074295809 10:112187649-112187671 CTGTGGGTAAAAAATTAATAAGG + Intronic
1075342014 10:121654575-121654597 CTGAAGGCATTCAATTCTTAGGG - Intergenic
1079516040 11:21270622-21270644 CTGCTGGCAGAAAATTCTTAAGG + Intronic
1079750793 11:24193934-24193956 CTGTATACATTAAATTATTTGGG - Intergenic
1079950963 11:26803843-26803865 CAGCAGTCATAAAATTATTGTGG - Intergenic
1085379668 11:76103232-76103254 CTGTAAACATAAAATTATCAAGG + Intronic
1085625564 11:78069453-78069475 CTGTAGGTATTAAGTCATTAAGG - Exonic
1085968128 11:81553873-81553895 CTTAAGGTCTAAAATTATTACGG + Intergenic
1087237817 11:95739684-95739706 GTGAAGCCATAAAATGATTAGGG - Intergenic
1087321111 11:96659730-96659752 CTTTAGGCATAAAATTAAATTGG - Intergenic
1087493335 11:98856646-98856668 CAGCAGGCAGAAAATCATTAAGG + Intergenic
1088042038 11:105397933-105397955 TTGTAAGCAAAATATTATTAGGG - Intergenic
1090739763 11:129647368-129647390 ATGTAGGCATGAAATCAGTAAGG + Intergenic
1092176802 12:6414679-6414701 CAGCAGGCAGAAAATCATTAAGG - Intergenic
1092867130 12:12772577-12772599 CAGTAGGCAGAAAATCAGTAGGG + Intronic
1092899751 12:13046892-13046914 CTGTAACAATAACATTATTATGG + Intronic
1094003001 12:25716464-25716486 CTCTAGGCACAAAATAATAAGGG + Intergenic
1095516005 12:43006169-43006191 TTGTAGGCATAGCATAATTATGG + Intergenic
1097403197 12:59154965-59154987 CGTTTTGCATAAAATTATTATGG + Intergenic
1097771721 12:63593923-63593945 CTGTAAGAATAATATTTTTAAGG + Intronic
1099920762 12:88954319-88954341 AGATAAGCATAAAATTATTATGG + Intergenic
1101313353 12:103605514-103605536 AAGTAGTCTTAAAATTATTAAGG - Intronic
1102654282 12:114467826-114467848 CAGCAGGCAGAAAATTAGTAAGG + Intergenic
1102851659 12:116252126-116252148 AAGTAGACATAAAATTAATAAGG + Intronic
1104630349 12:130395604-130395626 CTGTAGGTAAAAAGATATTATGG + Intergenic
1106395527 13:29377197-29377219 TTGTAGGCAGAAAATTACCAAGG + Intronic
1110548925 13:76790129-76790151 GTGTAATCATAAAATTATTTAGG + Intergenic
1110809202 13:79792612-79792634 CTGAAGGAAAAAAATAATTAAGG + Intergenic
1111904060 13:94235059-94235081 CTGTATGCTTAAAATTGTTAAGG + Intronic
1116620960 14:47202613-47202635 CTGTAAGGATAAAATTAGTCAGG - Intronic
1117769206 14:59115652-59115674 CTGAAAGCATCAAATGATTAGGG + Intergenic
1120351827 14:83370475-83370497 CTTTAGGCAACAAATTATAAGGG + Intergenic
1120484497 14:85094587-85094609 ATGTAGACCTAAAAATATTATGG - Intergenic
1120837067 14:89049576-89049598 CAGTAGGCAGAAAATCAGTAAGG + Intergenic
1121234494 14:92382562-92382584 GTGTGGGCATTAAATGATTAAGG - Intronic
1121922093 14:97891603-97891625 CTCTAGGCAAAAAATTATAATGG + Intergenic
1121966599 14:98312653-98312675 CTGTGGTGATAAAAATATTATGG - Intergenic
1126453326 15:48834134-48834156 CTGTAGACAGAAAATTATCTTGG - Intronic
1126611605 15:50535252-50535274 CAGCAGGCAAAAAATTAGTAAGG + Intronic
1129752162 15:78073615-78073637 CTGTAGGAGTAAAATCTTTATGG - Intronic
1133160598 16:3909105-3909127 CTGTTGGCATAAAAGTAATCGGG + Intergenic
1137543988 16:49386294-49386316 ATGCAGGCAGAAAATTAATAAGG + Intronic
1138058918 16:53867745-53867767 CAGCAGGCAGAAAATCATTAAGG - Intronic
1141247343 16:82320784-82320806 CTGGAGGCATAATACTACTATGG - Intergenic
1144048573 17:11476808-11476830 CAACAGGCAGAAAATTATTAAGG - Intronic
1144516579 17:15921755-15921777 CTGAATTCACAAAATTATTAGGG + Intergenic
1149727133 17:58907536-58907558 CAGCAGGCAGAAAATTAGTAAGG - Intronic
1149820001 17:59767052-59767074 CTGTATGCCTAAATTTATTCAGG + Intronic
1151755192 17:76071269-76071291 CAGTTTGCATAAAAGTATTAAGG + Intronic
1153848403 18:9070244-9070266 CTGTAGGCTTTAAATTGTTTAGG + Intergenic
1156109149 18:33702842-33702864 CAATGGGGATAAAATTATTAGGG + Intronic
1157084155 18:44560965-44560987 CTGTAGTTATAAAAATATCATGG - Intergenic
1157188882 18:45563554-45563576 ATGTAGGAAGAAAAGTATTACGG - Intronic
1159320059 18:66836628-66836650 CTATAGGGGTAAAATTATAAAGG - Intergenic
1159343517 18:67168815-67168837 CTGTTGTCATAAGATTTTTATGG + Intergenic
1164790404 19:30972631-30972653 CTGTAGGCAGAAATTTGATATGG + Intergenic
929397232 2:41536880-41536902 CTGTATGCTTATAAATATTATGG - Intergenic
929516626 2:42608985-42609007 CTATAACCATAAAATTATCAGGG - Intronic
930415305 2:51083377-51083399 ATATGGTCATAAAATTATTAAGG - Intergenic
934864970 2:97800161-97800183 TTGCAGTCTTAAAATTATTAAGG - Intronic
935750573 2:106229984-106230006 CAGCAGGCATAAAATCAGTAAGG - Intergenic
935836151 2:107056474-107056496 CTGTAGGCATAAACTTATTTAGG + Intergenic
936716012 2:115188462-115188484 CTATAGGCTTAAAATTACTCTGG - Intronic
938235248 2:129700575-129700597 CTGTATGCTTAAAATCATTAAGG - Intergenic
938855330 2:135304551-135304573 CTGAAGTTATAAAATTATTTGGG + Intronic
938972187 2:136442805-136442827 CTGTAGCAATAAAGTAATTAGGG - Intergenic
939635565 2:144578296-144578318 GTATAGGCAAAAAATAATTAAGG + Intergenic
940656298 2:156491619-156491641 CTGTAGGCAAAAATTTACAATGG - Intronic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
942982077 2:182094804-182094826 CAGTAGGCATAAATGGATTAAGG + Intronic
943764460 2:191645922-191645944 TTGTGGGCAAATAATTATTAAGG + Intergenic
944829953 2:203523604-203523626 GTGTAGGCAAAAATTTATTAGGG + Intronic
945518344 2:210791388-210791410 CTGTAGTGCTAAATTTATTAGGG + Intergenic
948663708 2:239521791-239521813 CAGTGGGCAGAAAAATATTACGG - Intergenic
1172366101 20:34350911-34350933 CTTTAGGCAAGAAATTATTCAGG + Intergenic
1172817690 20:37701489-37701511 CTCTATGAATAAAAGTATTATGG + Intronic
1173537301 20:43825394-43825416 CTGTAGCCCTAGAGTTATTAGGG + Intergenic
1173765269 20:45601688-45601710 CAGCAGGCAGAAAATTAGTAAGG - Intergenic
1174232654 20:49059150-49059172 CTTTAGAGATAAAATAATTAGGG + Intronic
1174496608 20:50948795-50948817 CTTTTGGCAAAAAAATATTAAGG - Intronic
1177786511 21:25677272-25677294 ATGTAGGCAAAAAATTATAAAGG - Intronic
1181900249 22:26148010-26148032 CGGTAGACATAAAATTAATAAGG + Intergenic
949763682 3:7501402-7501424 ATGTAGGCATGACATGATTAAGG + Intronic
950701180 3:14749214-14749236 CTTTAAGTAAAAAATTATTATGG - Intronic
952630817 3:35464287-35464309 CTGAAGGCATACAGTTATTCAGG + Intergenic
952650211 3:35717141-35717163 CTATGGGCATTAATTTATTATGG + Intronic
953739484 3:45524930-45524952 CTGTAGGCATAAAGTTGCTTGGG - Intronic
954769052 3:52949357-52949379 CAGCAGGCAGAAAATTAGTAAGG - Intronic
955433985 3:58880245-58880267 ATATATGCATAAAATTTTTAAGG - Intronic
956151155 3:66244407-66244429 AAGTAGGCATAAACTTACTAAGG + Intronic
956381161 3:68665906-68665928 ATTTAAGCAGAAAATTATTAAGG - Intergenic
956943473 3:74192515-74192537 CTCTAGGCATGTAATTTTTAGGG + Intergenic
958660324 3:97058710-97058732 TTGTAGGCAAAAAGTGATTAAGG - Intronic
959527489 3:107393969-107393991 CTATTGGCATAAGAATATTATGG + Intergenic
959774871 3:110146360-110146382 ATGTAGGCAGAAAATCAATAAGG - Intergenic
959837824 3:110941612-110941634 ATGTAAGTATAAATTTATTAAGG + Intergenic
963841348 3:150110423-150110445 CAGCAGGCAGAAAATTAGTAAGG - Intergenic
964400093 3:156289801-156289823 CTGCAGGAATAAAATTTTCAAGG - Intronic
965047279 3:163595656-163595678 CTGTAGTCAATATATTATTATGG + Intergenic
965247207 3:166288350-166288372 CTTGAGGGATAAAATTATTTTGG + Intergenic
965509773 3:169555556-169555578 CTGTAGGCCTAAAACCATGAAGG + Intronic
966620170 3:181954868-181954890 CTGCAGCCATGAAATTCTTATGG - Intergenic
967262361 3:187655398-187655420 CTGGAAGCATAAAATGCTTATGG + Intergenic
967724375 3:192847984-192848006 CTGTAGACATAAATGTATTTTGG - Intronic
968557664 4:1255786-1255808 CTGTACACTTAAAATGATTAAGG - Intergenic
972915017 4:43866329-43866351 CTGTGGTCATAAAATAATCAGGG - Intergenic
973177590 4:47226948-47226970 CTGTTGTCATAAAAATATTGAGG + Intronic
973899061 4:55448346-55448368 CTGTAGACATAAAGATATTAAGG - Intronic
973993286 4:56433212-56433234 GTGTAGGCATAGAATCATTAAGG - Intronic
975185392 4:71396373-71396395 ATATAGGCATTAATTTATTAGGG + Intronic
975454013 4:74567456-74567478 CTTGAGGCATAAAGTTATTAAGG - Intergenic
976069841 4:81228754-81228776 TTATAGTCATAAAATTATTGAGG + Intergenic
976783415 4:88787985-88788007 CTGTAGGCACAGATTTTTTAAGG - Intronic
978331936 4:107622813-107622835 CTGTAGGTATAAAAGTGTGATGG - Intronic
978433798 4:108661307-108661329 CTGTACTAATAAAAATATTAGGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979439138 4:120730408-120730430 ATGTAGAAATAAAATTATTTAGG + Intronic
980595139 4:134945015-134945037 CAGCAGGCAGAAAATTAGTAAGG + Intergenic
981676329 4:147347371-147347393 GTGGACCCATAAAATTATTATGG + Intergenic
982188012 4:152822014-152822036 CTGAAGGCATAAAATTCACAAGG + Intronic
982286171 4:153737849-153737871 AAGCAGGCATAAAATTAGTAAGG - Intronic
983352710 4:166613597-166613619 AAGTAGGCAAAAAAATATTAAGG - Intergenic
984326298 4:178255976-178255998 CTGCAGGTATAATATTATTAAGG - Intergenic
984405022 4:179317929-179317951 CAGCAGGCAGAAAATTAGTAAGG - Intergenic
984543905 4:181075133-181075155 TTTCAGGCATAAAATTTTTAGGG - Intergenic
986537086 5:8800231-8800253 ATTTAGACATAAAATTAATAAGG + Intergenic
987785930 5:22498497-22498519 AACTAGGGATAAAATTATTAAGG + Intronic
987981200 5:25086505-25086527 CTGTAGGCCTAAATTCCTTATGG - Intergenic
990570934 5:57077925-57077947 CAGTAGGCAGAAAATCATTATGG - Intergenic
991394966 5:66195524-66195546 TTGTAGGCAACAGATTATTAAGG + Intergenic
993740007 5:91527056-91527078 CTGCAGGCAAAAAATTATAGAGG - Intergenic
994800955 5:104374606-104374628 CTGTAGGCTAAAAATTAGAAAGG + Intergenic
996707197 5:126509446-126509468 CTGTCCTGATAAAATTATTAAGG - Intergenic
997571871 5:134935442-134935464 CTGCAGTTATAAAATTATTTTGG + Intronic
1000068150 5:157714398-157714420 CTGTAATCATAAACTTATTCTGG + Intergenic
1000397152 5:160787886-160787908 CTGTTGGCATCTAATTAATAAGG - Intronic
1000486843 5:161857141-161857163 CTGTGATCATAAAATTACTAAGG - Intronic
1000866096 5:166516882-166516904 CTGTAGTCATAAAATGATGAAGG - Intergenic
1004535419 6:16496008-16496030 CTGTTGACGTAATATTATTATGG - Intronic
1005557716 6:27005304-27005326 CAGCAGGCAGAAAATTAGTAAGG - Intergenic
1005964110 6:30714408-30714430 CTATACACTTAAAATTATTAAGG - Intronic
1007208379 6:40171187-40171209 CTGGAGGCAAAAGATTATCAGGG + Intergenic
1008701671 6:54107760-54107782 CTGAAGACATAAAATAATAAAGG - Intronic
1008968951 6:57344599-57344621 TTTTTGGCATCAAATTATTATGG + Intronic
1009533327 6:64848952-64848974 CTGCCAGCATAAAAATATTAGGG - Intronic
1009928869 6:70152615-70152637 CTGAACTCATAAGATTATTAAGG - Intronic
1012101523 6:95093350-95093372 CTGCAGGTATAAAATAAATATGG + Intergenic
1014972594 6:127835911-127835933 TTATGGGCATAAAATTATGATGG - Intronic
1017798955 6:157874519-157874541 CTGCAGGCAGAAAATCAGTAAGG + Intronic
1018018548 6:159735095-159735117 CTGTAGGAATATTTTTATTAAGG + Intronic
1019099083 6:169612797-169612819 CTGGTGGCATAAGATTATGATGG - Intronic
1020498152 7:8882696-8882718 CAGTGGCCATAAAATTAATATGG + Intergenic
1020972709 7:14966127-14966149 CTGTTGTAATAAAATTTTTATGG - Intronic
1022931280 7:35117584-35117606 CTGTAAGAATAATATTTTTAAGG + Intergenic
1023692339 7:42803283-42803305 CAGCAGGCATAAAATCAGTAAGG + Intergenic
1024445567 7:49474204-49474226 ATGTAGCCATAAAATAATTTAGG - Intergenic
1024667671 7:51562838-51562860 GTGTAGGCCTACACTTATTAAGG + Intergenic
1025306531 7:57865686-57865708 CCTTAGGAAGAAAATTATTAGGG + Intergenic
1025641273 7:63372881-63372903 ATGTGGGCATCAAAATATTAAGG + Intergenic
1028224118 7:88229996-88230018 CTGCAGCCATAAAAATAGTATGG - Intergenic
1028711142 7:93910090-93910112 CTGAAGCCATTAAAATATTAAGG + Intronic
1029827182 7:103210103-103210125 CTGTAAGAATAATATTTTTAAGG + Intergenic
1030119850 7:106098886-106098908 CTGTTAGAATAAAATTATCAAGG + Intronic
1031269743 7:119633523-119633545 CTGTAGCCACAAAAATATTGTGG + Intergenic
1032727418 7:134603710-134603732 CTAAAGGCACATAATTATTATGG - Intergenic
1037180027 8:15994351-15994373 GTGGAGCCATAAAATTATAATGG - Intergenic
1037486259 8:19350121-19350143 GTGTAAGCATAAAATAATAAAGG - Intronic
1038918977 8:32061171-32061193 CTCTAGGTATGTAATTATTATGG - Intronic
1039135854 8:34322115-34322137 TTATAGGCAGAAAATCATTAAGG - Intergenic
1041327564 8:56685190-56685212 ATGTAGTCAAAAAATTAATAAGG + Intergenic
1042345176 8:67719676-67719698 ATGCAGGCATAAAATAATGACGG + Intronic
1042626438 8:70763016-70763038 CTCTAGTCACAAAATTATTCAGG - Intronic
1043651437 8:82598001-82598023 CTTTAGGCATATAATTCATATGG + Intergenic
1044372364 8:91427173-91427195 TTGTAGGCATTCAATAATTATGG + Intergenic
1044406379 8:91831292-91831314 TTTTAGGAATAAAATTATTTGGG + Intergenic
1044788423 8:95821402-95821424 CTTTAGCAATAAAAATATTAAGG + Intergenic
1046742222 8:117841760-117841782 CTTTAAGTATAAAATGATTATGG - Intronic
1048388733 8:133939505-133939527 AGGTAGGCATATACTTATTAAGG - Intergenic
1050872855 9:10596306-10596328 CTATAGACATAAAATTCTTTGGG - Intronic
1052103736 9:24484611-24484633 CTGTACTCATAAAATAATTTGGG + Intergenic
1052780909 9:32781738-32781760 CTTTAGGCATAGAATCATTTAGG - Intergenic
1053523510 9:38806118-38806140 CTGTTGTCATAAAACTATGAAGG + Intergenic
1054195738 9:62030534-62030556 CTGTTGTCATAAAACTATGAAGG + Intergenic
1054642670 9:67558155-67558177 CTGTTGTCATAAAACTATGAAGG - Intergenic
1055103161 9:72485765-72485787 CTGTAGGCAAAAACTTCTTGGGG + Intergenic
1056648710 9:88438629-88438651 CAGAAGGCATAAAATCAGTAAGG - Intronic
1058474339 9:105316362-105316384 ATATATGCATAACATTATTAAGG + Intronic
1060480591 9:124014908-124014930 CTGTAGGCATAAGTGTGTTAAGG + Intronic
1186799806 X:13081444-13081466 ATGGAGGCATAAAATCATTCAGG + Intergenic
1187289819 X:17942313-17942335 TTTTATGCAAAAAATTATTAGGG + Intergenic
1187483393 X:19679030-19679052 CAGTAGGCGTAGAGTTATTAAGG - Intronic
1187772475 X:22715893-22715915 CTTTAAGCTTAGAATTATTAAGG - Intergenic
1188439354 X:30199510-30199532 CAGTAGGCAGGAAATTAGTAAGG + Intergenic
1188793323 X:34432230-34432252 CTGTTGGCATAAGATTTATATGG + Intergenic
1190780196 X:53586655-53586677 CTGTAGTTTTAAAATTATAAAGG - Intronic
1192188562 X:68975874-68975896 CTGTTGGCATAAAATTCTCTTGG + Intergenic
1194101468 X:89710852-89710874 TTGTAGCCATAAAATAATTTGGG - Intergenic
1194474533 X:94342432-94342454 TTTTATACATAAAATTATTATGG + Intergenic
1195897848 X:109766082-109766104 CAGCAGGCAGAAAATCATTAAGG + Intergenic
1196431526 X:115632264-115632286 CTGTAGAAAAAAATTTATTAGGG + Intronic
1198489890 X:137128863-137128885 CAGCAGGCAGAAAATTAGTAAGG + Intergenic
1198867607 X:141141303-141141325 CTGACTGCATAAAATTTTTATGG + Intergenic
1200454420 Y:3371936-3371958 TTGTAGCCATAAAATAATTTGGG - Intergenic