ID: 1065105152

View in Genome Browser
Species Human (GRCh38)
Location 10:22375999-22376021
Sequence CAAAAGTCTCATGTGAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065105152_1065105153 -7 Left 1065105152 10:22375999-22376021 CCTCTATTCACATGAGACTTTTG 0: 1
1: 0
2: 3
3: 30
4: 294
Right 1065105153 10:22376015-22376037 ACTTTTGCACACTTGAACTGAGG No data
1065105152_1065105154 9 Left 1065105152 10:22375999-22376021 CCTCTATTCACATGAGACTTTTG 0: 1
1: 0
2: 3
3: 30
4: 294
Right 1065105154 10:22376031-22376053 ACTGAGGCTAGTGCACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065105152 Original CRISPR CAAAAGTCTCATGTGAATAG AGG (reversed) Intronic
902127658 1:14230128-14230150 AAACAGCCTCATGTGACTAGTGG + Intergenic
902354925 1:15890974-15890996 CAATAGCCACATGTGACTAGTGG + Intronic
902887025 1:19412688-19412710 CAAAGTACTCATGTCAATAGAGG - Intronic
903240517 1:21979776-21979798 CAATAGTCACATGTGGCTAGTGG + Intronic
903244259 1:22004395-22004417 CAATAGTCACATGTGGCTAGTGG + Intronic
907012957 1:50980530-50980552 CAAAAGTAGCATGTAGATAGAGG + Intergenic
907084043 1:51652718-51652740 CAATAGCCACATGTGACTAGTGG + Intronic
907259506 1:53206782-53206804 CCAAAGTCTCATCTGAGTAAAGG - Intronic
909421293 1:75469268-75469290 CAATAGCTTCATGTGAAAAGAGG + Intronic
909476233 1:76084047-76084069 CAAAAGCCACATGTGGCTAGTGG + Intronic
909652843 1:77995040-77995062 TAAGAGTCTCATGTGGCTAGTGG - Intronic
910992007 1:93066416-93066438 GAAAGGTACCATGTGAATAGTGG + Intergenic
913316925 1:117561462-117561484 CAAAAGTCTCATGTGCACTGTGG - Intergenic
913358751 1:117954742-117954764 CAAAAGTCTCTTTTGAATCTTGG + Intronic
913368590 1:118070876-118070898 CAGAAGTTACATGTGACTAGTGG + Intronic
913664810 1:121037472-121037494 GAAAAGTGACATGTGAATGGGGG + Intergenic
914016202 1:143820747-143820769 GAAAAGTGACATGTGAATGGGGG + Intergenic
914161580 1:145140261-145140283 GAAAAGTGACATGTGAATGGGGG - Intergenic
914654819 1:149729288-149729310 GAAAAGTGACATGTGAATGGGGG + Intergenic
915122599 1:153640126-153640148 CAATAGCCACATGTGACTAGTGG - Intronic
915866916 1:159510974-159510996 CCAAATTCTCATGACAATAGTGG - Intergenic
916193209 1:162198847-162198869 CAGAAGCCACATATGAATAGTGG - Intronic
916502788 1:165401105-165401127 TAAAAGTCTCATGTGTAGAAAGG + Exonic
916660190 1:166916217-166916239 CAAAAGTCTGAACTGAAAAGAGG - Exonic
917329360 1:173866416-173866438 CAAAATTCTCATTTGAAAAGAGG + Intergenic
919076238 1:192816466-192816488 CAAATGTCTCATGTCAACAGTGG - Intergenic
919099975 1:193083471-193083493 CAAAAGTCCCATGTGATTAGTGG - Intronic
919985038 1:202667637-202667659 CAAAAGTCCCATGAGAGTAATGG + Intronic
922394145 1:225178653-225178675 CCAAAGTCTCATCTGAGAAGAGG - Intronic
923647315 1:235837076-235837098 CAAAAGCCACATGTGGCTAGGGG + Intronic
1064554541 10:16535254-16535276 CAATAGCCACATGTGACTAGTGG - Intergenic
1064804363 10:19113709-19113731 CAAAAGTTTCTTGTGAGTTGAGG + Intronic
1064806131 10:19135626-19135648 CAATAGCCTCATGTGATCAGTGG - Intronic
1065105152 10:22375999-22376021 CAAAAGTCTCATGTGAATAGAGG - Intronic
1066068606 10:31781372-31781394 TAAAAATCTCATGTCAATATGGG + Intergenic
1067798526 10:49339107-49339129 CACAAGACACATGTGAGTAGTGG + Intergenic
1068494071 10:57762843-57762865 CAAAAGTTTCATGTAGATGGAGG + Intergenic
1068809388 10:61238802-61238824 CAAAGGTCTCATGTGTATTTAGG + Intergenic
1069323083 10:67198122-67198144 GAAAAGCCACATGTGAGTAGTGG + Intronic
1071496593 10:86171555-86171577 CATAAGTCCCATGGGAAAAGAGG + Intronic
1071746544 10:88426290-88426312 AAGTAGGCTCATGTGAATAGTGG + Intronic
1071962849 10:90823535-90823557 CCAAAGTCTCATGTGAAACAAGG - Intronic
1072297088 10:94019609-94019631 CAAGAGTCACATGTGGCTAGTGG - Intronic
1072916788 10:99541813-99541835 CAAAAGTCACATGTCACTAATGG - Intergenic
1073789534 10:106926417-106926439 CAACTGTCTCATCTGAAAAGTGG + Intronic
1073806061 10:107099569-107099591 TAATAGTCTCATGTGGCTAGTGG + Intronic
1074019660 10:109569263-109569285 CAAAAGTCTTCTTTGAAAAGGGG + Intergenic
1074067234 10:110027606-110027628 CAGTAGTCACATGTGACTAGTGG + Intronic
1075201628 10:120409331-120409353 GGAAAGACTCATGTGAATGGAGG - Intergenic
1077819389 11:5721405-5721427 TAAGAGTCTCATTTAAATAGTGG - Intronic
1078801265 11:14645292-14645314 AAAAAGTGCCATGTGATTAGCGG - Intronic
1079918250 11:26398341-26398363 CAAAAGGCTCCTGTGAGTATAGG + Intronic
1080931515 11:36816298-36816320 CAACAGTCACATGTGACTAGTGG - Intergenic
1081819038 11:45973192-45973214 CAAAAGTCGCATGTGGTTAGTGG + Intronic
1081969890 11:47190764-47190786 CAACAGTCTCATGCTACTAGTGG - Intergenic
1082132464 11:48506732-48506754 CCAAAGTCTCATCTGAAAAGAGG - Intergenic
1083022639 11:59522897-59522919 CAAACTTCTCATGTGAAGAGAGG - Intergenic
1083678193 11:64339677-64339699 CAACAGTCTCGAGTGTATAGAGG + Intergenic
1084998660 11:73009075-73009097 CAAAAGTCTAATGCAAATTGAGG + Intronic
1086878208 11:92123556-92123578 CAATAGCCTCATGTGACTAGTGG + Intergenic
1088150695 11:106741330-106741352 CAATAGTCACATGTGGCTAGTGG + Intronic
1088197253 11:107288442-107288464 CAAAAGTTTTCTGTGAATACTGG - Intergenic
1088839581 11:113612988-113613010 CAATAGTCACATGTGGCTAGGGG - Intergenic
1090131150 11:124143421-124143443 CAATAGCCACATGTGACTAGTGG - Intronic
1090552253 11:127834689-127834711 CAAAAGACTCATCTGAAAAAAGG + Intergenic
1090786060 11:130048786-130048808 CAATAGTCCCATGTGACTAGTGG + Intergenic
1092021868 12:5209525-5209547 CAGAAAGCTCATGTGGATAGTGG + Intergenic
1093723629 12:22477295-22477317 CAAAAGTCACATGTGGCCAGCGG + Intronic
1096907666 12:54949952-54949974 CAAAAGGCCCAAGTGAAGAGAGG - Intronic
1098005649 12:65994147-65994169 CAAAAGCCACACGTGACTAGTGG - Intergenic
1098607728 12:72413338-72413360 CAATAGTCACATGTGGCTAGTGG - Intronic
1099115904 12:78623701-78623723 CCAAAGTATGATTTGAATAGAGG - Intergenic
1100274448 12:93058983-93059005 CCCAAATCTCATGTGAATATTGG + Intergenic
1100697691 12:97113467-97113489 CAATAGCCTCATGTGGCTAGTGG + Intergenic
1101558791 12:105836017-105836039 CATATGTCTCATGGGGATAGAGG + Intergenic
1101653879 12:106702795-106702817 CAAAAGCCTCAGTTGACTAGGGG - Intronic
1105422980 13:20269527-20269549 CAAAAGCCACATGTGACTAGTGG - Intergenic
1106816709 13:33416577-33416599 CAAGAGTGTCATTTCAATAGGGG + Intergenic
1107822124 13:44295705-44295727 AAATAGCCTCATGTGACTAGTGG + Intergenic
1107943073 13:45391918-45391940 CAAAAGGTTGATGTAAATAGTGG - Intergenic
1108036721 13:46297895-46297917 CCCAAGTCTGATGTCAATAGTGG - Intergenic
1109871754 13:68342180-68342202 CCAAAGCCTCATCTGAATGGAGG + Intergenic
1110352427 13:74524860-74524882 CCAAATTGTCATGTAAATAGAGG + Intergenic
1110607973 13:77455273-77455295 CAACAGCCACATGTGGATAGTGG + Intergenic
1111726941 13:92023189-92023211 TAGAAGTCTCAAGTAAATAGAGG - Intronic
1112582801 13:100690975-100690997 CAAAAGTCTCATGTGAGACAAGG - Intergenic
1114438015 14:22724136-22724158 CAACAGTCACATGTGACTAGGGG - Intergenic
1115997971 14:39213054-39213076 CAATAGTCACATGTGGCTAGTGG - Intergenic
1116774027 14:49159232-49159254 CAAAAAGATCATGTGACTAGAGG + Intergenic
1117192781 14:53309597-53309619 CAAAAGTCTCATCTGAGAAAAGG - Intergenic
1117414689 14:55483954-55483976 CAATAGCCACATGTGACTAGTGG - Intergenic
1117659804 14:57991909-57991931 GAAAAGTCTAAAGTGGATAGTGG - Intergenic
1117675441 14:58151332-58151354 CAAATGTCTCATGTGCCTCGTGG - Intronic
1117845067 14:59902469-59902491 CTAAAGACACATGTGAATAGTGG - Intergenic
1118976459 14:70681745-70681767 CAACAGTCACATGTGGCTAGTGG + Intergenic
1120584547 14:86295930-86295952 CAAAAGTCTCATGTTGTTATTGG - Intergenic
1121016977 14:90554868-90554890 CAAAAGCTTCCTGTGAACAGAGG + Intronic
1125753859 15:42049219-42049241 CCAGAGTCACATGTGAAGAGGGG - Intronic
1126149717 15:45512799-45512821 GAAAAGCCACATGTGACTAGTGG - Intronic
1126193996 15:45911219-45911241 CAAAAGGCTCAAGTGAGTACTGG + Intergenic
1128173026 15:65529890-65529912 CAAAAGCCTCATGTGGCTAGTGG + Intergenic
1128219970 15:65962191-65962213 AAAAAGGCTCATGGGAAGAGAGG + Intronic
1128511586 15:68316855-68316877 TTAAAAGCTCATGTGAATAGAGG - Intronic
1129013620 15:72445966-72445988 CAAAAGACTGATTTCAATAGTGG + Intergenic
1129900751 15:79147066-79147088 CAATAGTCACATGTGGCTAGTGG + Intergenic
1130108622 15:80947354-80947376 CAAAAGTATCATAAGAAAAGTGG + Intronic
1130791780 15:87162895-87162917 CAAAAGTGACATGTCAATAATGG - Intergenic
1131497717 15:92928608-92928630 TAAAAGCCACATGTGAGTAGTGG - Intronic
1131758543 15:95593662-95593684 CAGAAGTCTCATGTGTAACGCGG + Intergenic
1135567208 16:23520365-23520387 AGAAAGTCACATGTGAATAAGGG + Intronic
1135866590 16:26108493-26108515 CAAAAGGCAGAAGTGAATAGTGG + Intronic
1137923860 16:52520753-52520775 AAAAAGTTTCATGTGAATTCAGG + Intronic
1141188441 16:81806179-81806201 CAAAAGCCACATGTGGCTAGTGG + Intronic
1141249018 16:82338103-82338125 CATTTGTCTCATGTGAGTAGAGG + Intergenic
1142721037 17:1776063-1776085 CAAAAGCCTCCTTTGAACAGAGG - Intronic
1142776199 17:2141143-2141165 CAAAAGTCACATGTGGCCAGTGG + Intronic
1144428434 17:15168106-15168128 AAAATGTCACATGTGAATGGTGG - Intergenic
1144496837 17:15752204-15752226 CAAAAGCCACATGTGGGTAGTGG - Intergenic
1144606401 17:16669590-16669612 CAAAAGCCACATGTGGGTAGTGG - Intergenic
1144904802 17:18632694-18632716 CAAAAGCCACATGTGGGTAGTGG + Intergenic
1147162176 17:38574725-38574747 CAGAAGTCTCCTGAAAATAGGGG + Intronic
1147205680 17:38835734-38835756 ACAAAGTATCATGTGACTAGAGG + Intronic
1150453826 17:65291209-65291231 AAAAAGTCACATGTGGCTAGTGG - Intergenic
1153077089 18:1175388-1175410 CATAAGTCTCACTTGAATAGTGG + Intergenic
1153404234 18:4718001-4718023 CAAAAGCCACATGTGGTTAGAGG + Intergenic
1156110939 18:33726413-33726435 CAAAAGCCTCAAGTGGCTAGTGG - Intronic
1156597868 18:38568380-38568402 GAAAAGTCTCATGTATAAAGTGG - Intergenic
1157649209 18:49311087-49311109 CAAAAGTCACATGTGGCTAGAGG + Intronic
1158081498 18:53597412-53597434 CAAAAGCCGCATGTGGCTAGTGG + Intergenic
1158244343 18:55413850-55413872 AAAAATTATCATCTGAATAGTGG + Intronic
1165413752 19:35678372-35678394 CAGAACTCTCATGGCAATAGAGG - Exonic
1166476247 19:43127437-43127459 GAAAGGTCTTGTGTGAATAGTGG + Intronic
925277223 2:2658913-2658935 CCAAAGTCTCATCTGAAACGAGG + Intergenic
925436421 2:3842193-3842215 CAAGAAGCTCATGTGAATTGGGG + Intronic
927022919 2:19035976-19035998 AAATAGTCACATGTGACTAGTGG - Intergenic
929665576 2:43831590-43831612 CCAAAGGCACATGTGACTAGGGG + Intronic
930471900 2:51827022-51827044 AAAAAGTCACATATGATTAGTGG + Intergenic
930912252 2:56643027-56643049 CAGTAGTCTCATGTGGCTAGTGG - Intergenic
931486743 2:62701423-62701445 CAATAGTCACATGTGGTTAGAGG + Intronic
932133497 2:69208366-69208388 CAATAGCCACATGTGACTAGTGG - Intronic
932146298 2:69320693-69320715 CAAAAGACTCGTGTGAACACGGG + Exonic
933628905 2:84634371-84634393 CAATAGTTTTATGTGAATACTGG - Intronic
935655887 2:105422421-105422443 CAAAACTGTGATGGGAATAGTGG + Intronic
936281934 2:111149062-111149084 CGTAAGTCACACGTGAATAGCGG + Intronic
939447428 2:142328461-142328483 GAAAAGAACCATGTGAATAGAGG + Intergenic
940007616 2:149022367-149022389 CAAAAGACACATGTGGATAGTGG - Intronic
940130944 2:150381061-150381083 TAAAAGTATAATGTGAAGAGAGG - Intergenic
943148717 2:184081274-184081296 CAAAAGGCTAACGTCAATAGTGG + Intergenic
943450798 2:188039819-188039841 CAAAAGTCTCATCTGAAACAAGG - Intergenic
944999516 2:205333228-205333250 CAAAAGCCACATGTGGTTAGTGG - Intronic
945423339 2:209666376-209666398 CAAAAGTCACATTTTAAGAGAGG + Intronic
946657043 2:221959831-221959853 CAAAAGCCACATGTGACCAGTGG + Intergenic
947548782 2:231031777-231031799 CAATAGCCTCATGTGACTAGTGG + Intergenic
1168829094 20:834523-834545 CCAAAGTCTCTGGTGACTAGTGG - Intronic
1169526264 20:6429317-6429339 CAAAAGCCACATGGGACTAGTGG - Intergenic
1171457028 20:25277996-25278018 CAACAGTCTCATGGGGACAGGGG - Intronic
1175078564 20:56397463-56397485 CAAAAGTGCCATGCCAATAGAGG + Exonic
1177401830 21:20614610-20614632 CCAAAGTCTCATCTGAGTAAAGG - Intergenic
1177449448 21:21246172-21246194 GAAGAGTCTCATGGGAATTGAGG + Intronic
1178474117 21:32921425-32921447 AAATAGTCACATGTGATTAGTGG + Intergenic
1179358202 21:40681813-40681835 CAAAAGTCACATGTCGCTAGAGG + Intronic
1183896422 22:40973091-40973113 CAAAGGTCACATTTGTATAGCGG - Exonic
949892498 3:8743733-8743755 CTAAAGTCACATGAGAAAAGAGG + Intronic
950138237 3:10598100-10598122 CAAAAGTCTCATGGGAATTCAGG + Intronic
950155070 3:10715878-10715900 CAATAGGCTCATGTGGCTAGTGG - Intergenic
951482902 3:23180464-23180486 CAAAAGCCACATGTGGCTAGTGG - Intergenic
952487206 3:33824878-33824900 CAAAATTAACATGAGAATAGAGG - Intronic
952577893 3:34796685-34796707 CAAAAGTAACATGTGAACAGAGG + Intergenic
952756186 3:36869828-36869850 CAACAGTCACATGTGACGAGTGG + Intronic
954150960 3:48656802-48656824 CAAAAGTCTCCCGTGAATCCGGG + Exonic
954510944 3:51124347-51124369 CAACAGTCACATGTGGCTAGTGG - Intronic
955292462 3:57705219-57705241 CACAATTCTCAAGTAAATAGTGG + Intergenic
955490362 3:59475857-59475879 TAAAAGTCTTATTTAAATAGAGG + Intergenic
956595188 3:70959609-70959631 CAAAGGCCCCATGTGACTAGCGG + Intronic
957346322 3:78965882-78965904 CAAAAGCCTCCTGTGACTAGTGG - Intronic
957396753 3:79649528-79649550 CAAAAGAATCATGAGAAAAGAGG + Intronic
958428033 3:94002230-94002252 AAAAAGTCACATGTGGCTAGTGG - Intronic
959251970 3:103959978-103960000 CAAAACTCTCATTTGAAAATGGG + Intergenic
959633000 3:108530120-108530142 CAAGGGTTTCATGTCAATAGTGG + Intergenic
962029527 3:131584747-131584769 CAATAGTCTCATGTGGCTGGTGG - Intronic
962773317 3:138634059-138634081 CAACAGTCACATGTGGCTAGTGG + Intergenic
963228244 3:142884889-142884911 CAATAGCCACATGTGGATAGTGG - Intronic
963339672 3:144019563-144019585 CCAAAGTCTCATCTGAATCAAGG + Intronic
963394471 3:144714795-144714817 CCAAAGTCTCATTTGAAAAAAGG + Intergenic
963681127 3:148378623-148378645 AAATAGTCTCATGTGTCTAGTGG - Intergenic
963938731 3:151080334-151080356 CAATAGTCACATGTGGCTAGTGG - Intergenic
963978099 3:151505514-151505536 CAAAATTATCAGGTGAAAAGGGG + Intergenic
964949921 3:162277516-162277538 CAAAAGTGTCATGTTTACAGGGG + Intergenic
965662222 3:171053490-171053512 CCAAAGTCTCATGTGAAACAAGG - Intergenic
965791140 3:172388957-172388979 TAATAGTCTCATGTGATTATGGG - Intronic
966325157 3:178745614-178745636 CCAAAGTCTCATCTGAAAAAAGG + Intronic
966538962 3:181067523-181067545 CAAAAGTCACATGTGACTAGTGG - Intergenic
966862877 3:184240429-184240451 CAATAGTCAAATGTGACTAGTGG + Intronic
969904763 4:10383604-10383626 CCAAAGTCTCATCTGAAATGAGG - Intergenic
970077597 4:12242246-12242268 CAACAGTCTCATTTGAGTAATGG + Intergenic
970339054 4:15085661-15085683 CAAAAGTCTCATCTGAAACAAGG + Intergenic
971035043 4:22683886-22683908 CACACCTCTCATGTGATTAGTGG - Intergenic
971236444 4:24846606-24846628 CAAAAGTCCCACGTCAATAGAGG + Intronic
971378812 4:26077983-26078005 AAAAAGGCGCATGTGAACAGAGG + Intergenic
972001646 4:34043740-34043762 CAAATGTCACATGGGAAAAGTGG - Intergenic
972274302 4:37542607-37542629 CAAAAGCCACATGTGGCTAGTGG - Intronic
972697328 4:41460272-41460294 CAATATTCACATGTGACTAGTGG + Intronic
974152944 4:58033026-58033048 CAAAAATGTCATGAGAATACAGG + Intergenic
974979830 4:68941132-68941154 CAAAGGTCTCATGACAAGAGAGG - Intronic
975608698 4:76182255-76182277 CAGTAGTCACATGTGACTAGTGG - Intronic
975889894 4:79015149-79015171 CAATAGTCACATGTGGCTAGTGG - Intergenic
976037461 4:80841704-80841726 CAAAAGCTTCATTTGAAAAGAGG - Intronic
977292822 4:95181713-95181735 CAAAAGTCTCATGAAACTACAGG + Intronic
977658645 4:99555744-99555766 CAATAGCCACATGTGGATAGTGG + Intronic
980153321 4:129075643-129075665 CAAAAGCCCCATGTAACTAGTGG + Intronic
980395606 4:132210641-132210663 CAAGAGTTTCATGTGGCTAGTGG + Intergenic
982302837 4:153897836-153897858 CAAGAGTCTAATGTCAAAAGGGG + Intergenic
982627257 4:157782813-157782835 CTAGAGTCCCATGTAAATAGAGG - Intergenic
983316763 4:166142599-166142621 CAAAGTTCTCATTTGAATATTGG - Intergenic
983886862 4:172989332-172989354 CAAAAGTCTCATTTGAGATGAGG - Intronic
983943178 4:173557855-173557877 CAATAGCCACATGTGACTAGGGG - Intergenic
984800483 4:183711247-183711269 CAATAGTCACATGTGGCTAGTGG - Intronic
985080091 4:186255799-186255821 CAAAAATGTCATGTGAAAAATGG + Intronic
985330033 4:188821891-188821913 CAAGAGTGACATGTGACTAGGGG - Intergenic
985989570 5:3544231-3544253 CAAAAATCCCATGTGGACAGGGG - Intergenic
986154720 5:5163338-5163360 CCCAAGTCTCATCTGAATTGTGG + Intronic
987067570 5:14304295-14304317 CAGGAGTCTCATGTGAGTTGAGG + Intronic
987744786 5:21956814-21956836 AAAGATTCTCATGTGATTAGAGG - Intronic
987754268 5:22080579-22080601 AAAAAGGCACATGTGACTAGAGG - Intronic
989311536 5:40024550-40024572 TAAAAGTCAAATGTGAATATTGG - Intergenic
990033122 5:51285776-51285798 AAAAAGTCTCATGTCACTACAGG + Intergenic
991764993 5:69966944-69966966 AAAGATTCTCATGTGATTAGAGG - Intergenic
991782332 5:70151209-70151231 AAAGATTCTCATGTGATTAGAGG + Intergenic
991844225 5:70842015-70842037 AAAGATTCTCATGTGATTAGAGG - Intergenic
991874775 5:71151524-71151546 AAAGATTCTCATGTGATTAGAGG + Intergenic
992275935 5:75118641-75118663 CAAAAGCCACATGTGACTAGTGG - Intronic
993371275 5:87095848-87095870 TAAAATTCTCATCGGAATAGTGG + Intergenic
993734022 5:91454359-91454381 GAAAAGTGTAATATGAATAGTGG - Intergenic
994056557 5:95423114-95423136 CAAAATGCTCATTGGAATAGAGG - Intronic
995377139 5:111487711-111487733 CAATAGTCACATGTGGCTAGTGG + Exonic
995916815 5:117256720-117256742 CAAAAGTCACATGTGGCTAGTGG + Intergenic
996246488 5:121270862-121270884 CCAAAGTCTCATCTGAAATGAGG + Intergenic
996330928 5:122327948-122327970 GAAAAGTCTCATGTGATTTAGGG + Intronic
997384390 5:133461129-133461151 CAAAACTCTCTTGTGAGTTGTGG + Intronic
998056105 5:139078963-139078985 CAAAAGCCACATGTGACCAGGGG - Intronic
998506562 5:142677263-142677285 CATCAGTCTGATGGGAATAGTGG - Intronic
998896762 5:146808284-146808306 CAACAGTCACATGTGCCTAGCGG + Intronic
999117842 5:149179741-149179763 AAATAGTCACATGTGATTAGTGG - Intronic
1000191081 5:158911436-158911458 AAAATGTCTCATGAGGATAGAGG + Intronic
1001781278 5:174371120-174371142 TAAAAGTATCATGGGAATAGAGG - Intergenic
1003100880 6:3175789-3175811 AAAAGGGCTCATGTGATTAGGGG - Intergenic
1003485014 6:6568039-6568061 CAAAACTTTCATCTGAAGAGAGG + Intergenic
1006270888 6:32966612-32966634 CAATAGCCACATGTGACTAGTGG - Intronic
1006292609 6:33151467-33151489 CAATAGCCACATGTGAATAGTGG + Intergenic
1007906116 6:45462606-45462628 AAAAACTCTATTGTGAATAGTGG - Intronic
1008873020 6:56294647-56294669 CAAATGTATAATGTGTATAGTGG + Intronic
1008895623 6:56551458-56551480 CAGAAGTCACATCTGTATAGGGG - Intronic
1010174037 6:73005747-73005769 CAAAGGCCTCATCTGCATAGAGG - Intronic
1010794080 6:80099394-80099416 TTAAAGTCTCATGTGAATTTGGG + Intergenic
1010838599 6:80620286-80620308 CAAGAGTCTCATGTGTATCTAGG + Intergenic
1011403226 6:86987538-86987560 CAATAGGCACATGTGATTAGTGG - Intronic
1011904816 6:92351544-92351566 CCTAAGTCTCATGTAAATATAGG + Intergenic
1014055027 6:117003611-117003633 CAATAGTCACATGTGACTGGTGG + Intergenic
1014618079 6:123629189-123629211 TAAAATTATCATGTGATTAGGGG - Intronic
1014865486 6:126524250-126524272 CAAAAGTCTGATGTTGATTGAGG - Intergenic
1015661239 6:135575985-135576007 CAAAAGCCCCATGTGCACAGGGG - Intergenic
1018060677 6:160087354-160087376 CAACAAACTCATGTGAACAGTGG - Intronic
1018358347 6:163040854-163040876 CCAAAGTCTCATCTGAAAAAAGG - Intronic
1018987224 6:168647111-168647133 CAGAAGTCTCAGGTCAACAGAGG - Intronic
1019301801 7:308762-308784 CAAATGTTTCATGTGAATTTGGG - Intergenic
1020346300 7:7167765-7167787 CAACAGTCTCAGGAGAATAAGGG - Intronic
1021342959 7:19487964-19487986 CTAAAGTCACATGTCAATAGAGG - Intergenic
1021361501 7:19718588-19718610 AAATAGTCACATGTGGATAGTGG + Intergenic
1022160992 7:27711231-27711253 GAAAACTGTCATGTGAAAAGTGG - Intergenic
1025168396 7:56734145-56734167 GAAAAGTCTCTTTTGAATATAGG + Intergenic
1025703990 7:63845740-63845762 GAAAAGTCTCTTTTGAATATAGG - Intergenic
1025711120 7:63911004-63911026 CAAAACTCTCCTATGATTAGTGG - Intergenic
1028824233 7:95251095-95251117 CAAAAGTTTCTTGTTAAAAGGGG + Intronic
1029187085 7:98746979-98747001 CAAAAGTCTCCTGTAATCAGGGG + Intergenic
1030084392 7:105804252-105804274 CTAAACTCTGATATGAATAGAGG + Intronic
1030108029 7:106003265-106003287 AATAACTCTCATGTGACTAGTGG + Intronic
1031909359 7:127498557-127498579 CAATAGGCTCATGTGTCTAGTGG - Intergenic
1032633520 7:133680728-133680750 CAAAAGACTTCTGTGATTAGGGG - Intronic
1032950261 7:136900933-136900955 CAAAATTCTGTTATGAATAGAGG - Intronic
1033067816 7:138172878-138172900 CAGAACTCTCATGTGACTATGGG + Intergenic
1034195499 7:149243860-149243882 CAAAAGCCACATGTGCCTAGTGG - Intronic
1037517966 8:19652651-19652673 CCAAAGTCTACTGTAAATAGAGG - Intronic
1038059688 8:23899303-23899325 CAAAAGCCTCATGAGAATGCTGG + Intergenic
1038802697 8:30763661-30763683 AAAAAGTCTAAAGTTAATAGTGG - Intronic
1039719364 8:40145670-40145692 CAAAAACATCATGTGAAAAGCGG + Intergenic
1041823843 8:62068934-62068956 CAAAAGTCTCATCTGAGAAAAGG - Intergenic
1042384674 8:68160194-68160216 GAAAAGACTGATGTGAATATAGG - Intronic
1043356739 8:79422642-79422664 CAATAGTCACATGTGAGTAAAGG - Intergenic
1043370633 8:79587041-79587063 CAAAAGTGTAATATAAATAGAGG + Intergenic
1044188537 8:89284522-89284544 CCAAAGTCTCATGTGAAACAAGG - Intergenic
1044760960 8:95517012-95517034 CAAAAGAGTCATGTGAAGAGAGG - Intergenic
1045404659 8:101853776-101853798 CAATTGTCTCTTGAGAATAGAGG - Intronic
1046359582 8:113132354-113132376 CCCAAGTCTCATGTTAATTGAGG + Intronic
1046640289 8:116721912-116721934 CAAAAGTCTCATCTGAAACAAGG - Intronic
1049834185 8:144723165-144723187 TAAAACTCTCTTGTGAATATTGG + Exonic
1050242305 9:3649796-3649818 AGAAAATCTCATGTGAATATTGG + Intergenic
1050572352 9:6954247-6954269 CAAGAGTCTCAGGAGAAAAGAGG - Intronic
1051517560 9:17947348-17947370 CAAAATTATCAAGTGCATAGTGG - Intergenic
1051771313 9:20583010-20583032 CCAAAGTCTCATGTGAGAAAAGG + Intronic
1052446189 9:28564834-28564856 CAATAGTCACTTGTGACTAGTGG + Intronic
1056380315 9:86051820-86051842 AAAAAGTCTTATGTGAAAAGGGG - Intronic
1056642366 9:88382449-88382471 CAAAAGTCTGGTGAGAGTAGGGG - Intergenic
1058597024 9:106626104-106626126 CAAAAGCCACATGTCACTAGTGG + Intergenic
1059133027 9:111774946-111774968 CAAATGTCTCATCTTACTAGAGG - Intronic
1186186302 X:7023104-7023126 GAAAGGTCTTGTGTGAATAGTGG + Intergenic
1187642661 X:21312138-21312160 CAAATGTCTTATGTTAATAAGGG - Intergenic
1188871339 X:35377015-35377037 CAATAGCCACATGTGACTAGTGG + Intergenic
1188986712 X:36774614-36774636 GAAAAGTTTCATGGGCATAGGGG - Intergenic
1191112430 X:56814809-56814831 CAAGAGTCTAAGGTGAACAGCGG - Intergenic
1192407835 X:70904689-70904711 CAATAGTCACATGTGGCTAGTGG - Intronic
1192588177 X:72337276-72337298 CAATAGCCACATGTGACTAGTGG - Intronic
1192595772 X:72406830-72406852 CAAAAGTCACATATGACTAGTGG + Intronic
1193427188 X:81354174-81354196 CAAAAGTCACATGTGACTAGTGG - Intergenic
1193732104 X:85113979-85114001 TAAAAGTCTCTTGTGAAAACCGG - Intergenic
1194192873 X:90858489-90858511 CAAAAGTCTCATCTGAGGAAAGG - Intergenic
1195284390 X:103369532-103369554 CAAATGTTTCCTGTAAATAGGGG + Intergenic
1195498275 X:105563650-105563672 CCAAAGTCTCATGGGAACAAAGG + Intronic
1196468812 X:116001933-116001955 CAAAAGTCACATTTGGATACTGG - Intergenic
1197003559 X:121469292-121469314 CAAAAGTATCATGAAAATATTGG + Intergenic
1197312445 X:124921769-124921791 CAATAGTCACATGTGGCTAGTGG - Intronic
1197379516 X:125722271-125722293 CTAAAGTCTCATCTGAAAAAAGG - Intergenic
1197520750 X:127493003-127493025 CAAAAGTCTTATGAGAAGAGAGG - Intergenic
1198207598 X:134482512-134482534 CAAAAGCCACATGTCACTAGTGG - Intronic
1198575913 X:138010088-138010110 CAATAGCCACATGTGACTAGTGG + Intergenic
1199329456 X:146542344-146542366 CCAAAGTCTCATCTGAAATGAGG + Intergenic
1200539497 Y:4440937-4440959 CAAAAGTCTCATCTGAGGAAAGG - Intergenic
1201561821 Y:15325245-15325267 GAAAGGTCTTGTGTGAATAGTGG + Intergenic
1202201831 Y:22360316-22360338 CGAAAGTCACATGTAAATATGGG - Intronic