ID: 1065105153

View in Genome Browser
Species Human (GRCh38)
Location 10:22376015-22376037
Sequence ACTTTTGCACACTTGAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065105152_1065105153 -7 Left 1065105152 10:22375999-22376021 CCTCTATTCACATGAGACTTTTG 0: 1
1: 0
2: 3
3: 30
4: 294
Right 1065105153 10:22376015-22376037 ACTTTTGCACACTTGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065105153 Original CRISPR ACTTTTGCACACTTGAACTG AGG Intronic
No off target data available for this crispr