ID: 1065110398

View in Genome Browser
Species Human (GRCh38)
Location 10:22435619-22435641
Sequence AGGGGGCAGAAAGCATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 448}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110398_1065110410 25 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110398_1065110411 26 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110398_1065110409 24 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data
1065110398_1065110406 -1 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110406 10:22435641-22435663 TTTGGGGAAAGTATGCCTCACGG No data
1065110398_1065110412 27 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110398 Original CRISPR AGGGGGCAGAAAGCATGAAG TGG (reversed) Intronic
902350513 1:15850030-15850052 AGGGGGCAGAGAGAAGAAAGAGG + Intronic
904323385 1:29711135-29711157 AGAGGGGAGAAAGGAGGAAGAGG + Intergenic
904995132 1:34625786-34625808 AGGAGGCAGAAAGGAGGGAGTGG - Intergenic
905124528 1:35707789-35707811 AGGGCGCACAAAGCAGGGAGGGG - Intergenic
905487130 1:38309447-38309469 AGGGGGAAAAGGGCATGAAGGGG - Intergenic
905901228 1:41583156-41583178 AGGCGGCAGAAGGCATTGAGTGG + Exonic
906300219 1:44676054-44676076 TGGTGGCACAAAGCATGGAGTGG + Intronic
906838508 1:49110134-49110156 AGGGAGGAGAAAACAGGAAGGGG - Intronic
907158458 1:52354946-52354968 AAGGGGGAGAAAGCAAGGAGGGG + Intronic
907250270 1:53133488-53133510 GGGAGGCAGAACGCATGCAGAGG + Intronic
907822129 1:57980526-57980548 AGGGGCAAGAAAGCATGAGTGGG - Intronic
907826674 1:58023985-58024007 ACGCAGCAGAAAGCAAGAAGAGG - Intronic
907912796 1:58841512-58841534 AGGTGGCAGAAAGGGAGAAGAGG + Intergenic
910326379 1:86012847-86012869 AGTGAGCAGAATGAATGAAGAGG - Intronic
910459778 1:87436698-87436720 AGGGAGCAGACAGCAGGAATGGG - Intergenic
911831024 1:102551442-102551464 CGGGGGCAGGGAGCATGTAGAGG - Intergenic
912213046 1:107576114-107576136 ATGGGGCTGAAAGTATAAAGGGG - Intronic
912697026 1:111849399-111849421 AGGGGGCAGAGAGGAAGATGGGG - Intronic
912698812 1:111861145-111861167 AAAGGGCAGAAAGGAGGAAGGGG + Intronic
914317006 1:146522968-146522990 AGGGAGCAGACAGCAGGAACAGG - Intergenic
914497349 1:148210392-148210414 AGGGAGCAGACAGCAGGAACAGG + Intergenic
915579192 1:156803355-156803377 AGGGGGCAGATAGGATGAAAGGG + Intergenic
915850511 1:159316756-159316778 CGTTGGTAGAAAGCATGAAGTGG - Intergenic
916504836 1:165419106-165419128 ATGGGGCAGGAAGAATGGAGAGG + Intronic
916551952 1:165858333-165858355 AGGAGGCACAGGGCATGAAGAGG - Intronic
916692936 1:167208625-167208647 AAGGGGAAGCAAGCATGAAGAGG + Intergenic
917512586 1:175680645-175680667 AGGGGTCAGAAAGCATGCTAAGG + Intronic
917526514 1:175792962-175792984 AAGTGGTAGAAATCATGAAGGGG + Intergenic
918445798 1:184615588-184615610 AGCTGTCAGAAAGCAGGAAGTGG - Intronic
918532935 1:185542898-185542920 AGTGGGAAGAAAGAATGAAAAGG - Intergenic
918910295 1:190559190-190559212 AGGGGTCAGAAATCATAAATGGG + Intergenic
920417666 1:205809696-205809718 AGGGGACAAAAGGCATAAAGAGG + Intronic
921334004 1:214067956-214067978 TGGGGGCAGAAAGGATGAGGGGG + Intergenic
921341535 1:214139008-214139030 AGGAGGCAGAAAGCAGAGAGGGG + Intergenic
922344716 1:224686941-224686963 AAGGGGCAAAAGGCAGGAAGAGG - Intronic
922718115 1:227887359-227887381 AGGGGGCAGAATGGAGGAAGAGG - Intergenic
923239015 1:232062385-232062407 AGGGGGCAGGAAGTAGGGAGGGG + Intergenic
923718512 1:236447610-236447632 AGGGGTCAGCAAGCTTCAAGTGG + Intronic
924003035 1:239574793-239574815 AGGAGGAAGAAAGAAAGAAGAGG - Intronic
924221246 1:241877470-241877492 AGGGGGCAGGAAGCAGTACGTGG - Intronic
924408729 1:243780634-243780656 AGAGGGAAGAAAGGAAGAAGAGG + Intronic
1064705061 10:18063209-18063231 AGGGGGAGGAAAGGATGAACAGG - Intergenic
1064723313 10:18251768-18251790 AGGGGACAGAGAGCGCGAAGAGG + Intronic
1065110398 10:22435619-22435641 AGGGGGCAGAAAGCATGAAGTGG - Intronic
1065366673 10:24944051-24944073 AAGGGGGAGAGAGGATGAAGGGG - Intronic
1065503585 10:26406885-26406907 AGGGTGCAGAAAACATTAAAAGG - Intergenic
1065627079 10:27640770-27640792 ATGGGGAAGAAAACATGAAGTGG + Intergenic
1065780485 10:29162208-29162230 AGGGGAAAGAAAGAAAGAAGAGG + Intergenic
1065886617 10:30083317-30083339 AGGTGGTAGAAAGGATAAAGGGG - Intronic
1067325920 10:45266276-45266298 AGAGGCCAGGAAGCATGAACTGG + Intergenic
1068049242 10:51928153-51928175 AAGGGCCAGAAAGCTTGAGGTGG + Intronic
1068100965 10:52552518-52552540 AGTGGGCAAAAGGCATGAACAGG - Intergenic
1068489048 10:57698722-57698744 AGGGGCAAGAAAGAATAAAGGGG + Intergenic
1068766878 10:60773983-60774005 AGGGGGGAAAAGTCATGAAGAGG - Intergenic
1069536803 10:69259745-69259767 AGGAGGAAGAAAGAGTGAAGGGG + Intronic
1069551491 10:69367414-69367436 AATGGGCAGACAGTATGAAGTGG + Intronic
1072048225 10:91678367-91678389 AGGGGGGAGAAGATATGAAGGGG + Intergenic
1072614757 10:97042198-97042220 AGGGGGTAGAAGGCAAGAAAGGG + Intronic
1073679761 10:105690005-105690027 TGGGGGCAGGGAGCAAGAAGGGG + Intergenic
1074375111 10:112934074-112934096 AGGGGCCAGAAACCAGGAACGGG + Intergenic
1074845961 10:117398292-117398314 AGGAGACAGAAAGAATAAAGGGG + Intergenic
1077552281 11:3206049-3206071 AGGGGGCAGAAAGGAAGGAAGGG - Intergenic
1077791880 11:5449967-5449989 TGGGGGCAGAAAGAAGGTAGAGG - Intronic
1077884984 11:6380740-6380762 AGGGGCCAGCAGGCAAGAAGAGG + Intergenic
1078688067 11:13551329-13551351 AGGAGGCAGAAAGGAGAAAGAGG + Intergenic
1078747588 11:14129874-14129896 AGGAGACAGCAAGAATGAAGGGG + Intronic
1078825717 11:14928498-14928520 AGTGGGCAAAAAACATGAACAGG - Intronic
1080077861 11:28173287-28173309 AGGGTGAAGCAATCATGAAGGGG + Intronic
1081441979 11:43090818-43090840 AGCGGGGAGAGAGCAGGAAGTGG + Intergenic
1081866132 11:46361725-46361747 AGGAAGCAGAAAGCAAGGAGGGG - Intronic
1083029484 11:59579030-59579052 AGGGGACAGAGAGCAAGAAGTGG - Intronic
1083931815 11:65850371-65850393 AGGGGGCAGGCAGGATGATGGGG + Intronic
1085064913 11:73485922-73485944 CGGGGGCTGAAAACTTGAAGAGG - Intronic
1085076382 11:73596763-73596785 ATGGGGCAGAGAGGATGGAGAGG - Intronic
1086047500 11:82549986-82550008 ATGGGTCAGAAGGGATGAAGGGG - Intergenic
1086252163 11:84829013-84829035 AGGGGACAGAGAGCCTGAGGCGG - Intronic
1086282767 11:85210024-85210046 AGTGGGCAGAAAGGATGATGAGG - Intronic
1086616048 11:88821385-88821407 AGGGGGCATAAAGTAGGAGGAGG + Intronic
1087364182 11:97198360-97198382 AGAGGCCAGAAAGCATGAACTGG - Intergenic
1088363885 11:109018862-109018884 AGCAGGGAGAAAGGATGAAGAGG - Intergenic
1088753297 11:112864366-112864388 AGGGGGAAGAAATCAAGAATTGG - Intergenic
1089391242 11:118103320-118103342 AGGGGGCAGATACTATGCAGTGG - Intronic
1089463146 11:118664773-118664795 AGGGAGATAAAAGCATGAAGGGG + Intronic
1089628759 11:119770395-119770417 AGGGGGCAGAAAACCGGCAGAGG - Intergenic
1090053638 11:123402647-123402669 AGAGAGCAGAAAGTCTGAAGTGG - Intergenic
1090070159 11:123537034-123537056 ACGGGGCAGAAAGAATCCAGTGG - Intronic
1090428291 11:126625673-126625695 AGGGGGCAAAGAGCATAAAGTGG - Intronic
1090520654 11:127475518-127475540 CGGGGGCAAAAAGCAGGAAAGGG - Intergenic
1091006974 11:131962236-131962258 AGGGGGTAGGAAGGATCAAGGGG + Intronic
1091241405 11:134054858-134054880 AAGGGGAAGAGAGCAAGAAGGGG + Intergenic
1091309837 11:134564528-134564550 AGGGGTCAGAATGCAGGAGGAGG + Intergenic
1091330958 11:134730528-134730550 AGGGGAGAGAAAGCACGAAGGGG - Intergenic
1092329613 12:7571578-7571600 AGGAGAAAGTAAGCATGAAGAGG + Intergenic
1092773501 12:11920024-11920046 AGGGGGAAGGAGGCATGAATAGG - Intergenic
1093083916 12:14845532-14845554 ATGGGGCAGGGAGCAGGAAGGGG + Intronic
1094569709 12:31630947-31630969 AGCAGGCAGAAACCATGAAGAGG - Intergenic
1094713076 12:32985086-32985108 AGGAGGCAAAAATGATGAAGAGG - Intergenic
1095466125 12:42489737-42489759 GGGAGGAAGAAAGCATGGAGAGG - Intronic
1096378804 12:51137911-51137933 AGAGGGAAGAAAGCATGAGCTGG - Intronic
1096495034 12:52034903-52034925 AGCAGACATAAAGCATGAAGCGG - Intronic
1097246213 12:57609210-57609232 AGGGGGCAGAGAGGAGAAAGAGG - Exonic
1097703825 12:62847143-62847165 AGGCAGCAGAAGGCAAGAAGGGG + Intronic
1098186046 12:67897316-67897338 AAGAGGCAAAAAGCAGGAAGAGG + Intergenic
1098416557 12:70241927-70241949 AAGGAGGAGAAAGCAGGAAGAGG + Intergenic
1098607845 12:72415513-72415535 GGGGAGCAGAAAGGAGGAAGAGG - Intronic
1098807525 12:75038107-75038129 AAGGGGAAGAAAGGATGAATTGG + Intergenic
1098975549 12:76898349-76898371 AGAGGGCAGAAAATATGAAAAGG + Intergenic
1100457563 12:94767367-94767389 AGAGGGCAGCAAGCAAGAGGAGG + Intergenic
1101220612 12:102635375-102635397 GGTGGGCAGGAAGCATGAATAGG + Intergenic
1101693320 12:107101402-107101424 AGAGGGCAGAAAACATGGATGGG - Intergenic
1101774655 12:107782582-107782604 AGAGGGCAGACAGCCTGAAGGGG + Intergenic
1103152858 12:118656451-118656473 GAGGGGCAAAAAGCATCAAGAGG + Intergenic
1103773986 12:123351756-123351778 ATGGGGCAGAGAGAAAGAAGGGG + Intronic
1104433048 12:128732442-128732464 AGGGAGCAGGGAGCATGATGAGG - Intergenic
1105328952 13:19396541-19396563 AGGGAGCAGAAAGCAGGGTGTGG - Intergenic
1106240002 13:27904095-27904117 AGGGGGCAGAAAGGAGAAAGAGG - Intergenic
1106583059 13:31034115-31034137 AGAGGGCAGAAGGCAAGCAGGGG - Intergenic
1106717409 13:32405871-32405893 AGGGGGCAGGAAGCAGATAGTGG - Intronic
1106736859 13:32596800-32596822 AATGGGCAGAAAGCTTGAAGAGG - Intronic
1106744479 13:32685316-32685338 AAGGGCCAAAAGGCATGAAGAGG + Intronic
1107914643 13:45137093-45137115 AGGAGGCAGACAGGATGGAGGGG - Intronic
1108258906 13:48637672-48637694 AGGGGCCAGAAATCATCCAGTGG + Intergenic
1108304065 13:49113241-49113263 AGGGGGAAGCAAGCAAGGAGAGG - Intronic
1108791123 13:53970369-53970391 AGGAGGAAGAGAGAATGAAGGGG + Intergenic
1110174447 13:72538918-72538940 AGGGGACAGTATGCATGTAGGGG + Intergenic
1110395511 13:75025448-75025470 AGAGGGAAGAAAGCAAGAAGAGG + Intergenic
1111497708 13:89074554-89074576 AGGAGGGAGAAAGTGTGAAGAGG - Intergenic
1111584828 13:90270299-90270321 ATTGGGCAGGAAGCATGATGGGG + Intergenic
1111751425 13:92335889-92335911 AGGGCTCAGAAGACATGAAGAGG - Intronic
1111830361 13:93321948-93321970 AGGGGGAAGAAGGGAGGAAGAGG - Intronic
1112597912 13:100826160-100826182 AGGATGCAGAGAGCATGAGGCGG - Intergenic
1113307100 13:109090526-109090548 AAGGGGCAGAATGCAAGAAGGGG + Intronic
1113643385 13:111974315-111974337 AGGGGGCAGCAAGAACGTAGAGG + Intergenic
1115406747 14:33025726-33025748 AGGAGAGAGAAAGAATGAAGGGG - Intronic
1115541030 14:34421602-34421624 AGAGGGAAGAAAGAAAGAAGGGG - Intronic
1115786524 14:36832585-36832607 AGCCTGCAGAAAGCATGAAAAGG - Intronic
1115998429 14:39217345-39217367 AGGGGGAGGAAAGAAGGAAGTGG + Intergenic
1116831219 14:49721831-49721853 AGGGTGCAGAAAGCATAAAGTGG - Intronic
1116968927 14:51044518-51044540 AGAGGGCAGAAAGAATAAAATGG - Intronic
1118699233 14:68416865-68416887 AGGGACCAGATAGCATGAGGAGG + Intronic
1120023599 14:79556919-79556941 AGGGGGCAGGAGGGAAGAAGTGG - Intronic
1120112772 14:80577563-80577585 TGGCAGCAGAGAGCATGAAGAGG - Intronic
1121139783 14:91531279-91531301 AGGAAGCAGGAAGCAGGAAGGGG + Intergenic
1121295177 14:92814835-92814857 AGGGGTCAGAAAACATTGAGAGG + Intronic
1122341088 14:101028988-101029010 AGGCAGCAGAAGGCATTAAGTGG + Intergenic
1123694285 15:22865877-22865899 AGGGAGGAGAAACCATGAGGTGG - Intronic
1124077732 15:26461865-26461887 AGGGCGCAGGAGGCATGATGCGG - Intergenic
1124137640 15:27048860-27048882 AGGGGGCAGGAAGGAAGGAGAGG - Intronic
1124405886 15:29391210-29391232 AGGGGGCAGAAAGCATGGACAGG - Intronic
1124569984 15:30854254-30854276 AGCGGCCAGAAAGCTTGAACTGG - Intergenic
1125218997 15:37311492-37311514 TGGGGGCAAATAGAATGAAGAGG - Intergenic
1126520904 15:49592845-49592867 AGTGGGCAGGAAGCTTGAACTGG - Intronic
1126810521 15:52398568-52398590 AGGGGGATGAAAGAAGGAAGGGG - Intronic
1127272531 15:57414216-57414238 AGGGAGCCCAAAGGATGAAGGGG - Intronic
1128708284 15:69853142-69853164 GGGGGGCAGAAAGAATTCAGTGG + Intergenic
1129254817 15:74328236-74328258 TGGGGGCAGCAAGGAGGAAGAGG + Intronic
1131478703 15:92763676-92763698 GGGGGCCAGACAGCCTGAAGAGG - Intronic
1131781477 15:95864300-95864322 AGGGGGAAGAAAGGAAGAAAAGG + Intergenic
1131999094 15:98162123-98162145 AGTGGGCAGAATGAATGCAGTGG - Intergenic
1132833117 16:1939175-1939197 CGGGGACAGAAAGCAAGCAGGGG + Intronic
1133263991 16:4572150-4572172 CTGGGGTAGAAAGCATGGAGGGG - Intronic
1133586489 16:7200822-7200844 AGCGCGGAGAAAGCATGAAAGGG - Intronic
1134615981 16:15651122-15651144 AGGAGGCAGAAAGCCTGAGATGG - Intronic
1135661007 16:24296589-24296611 AGGGGGAAGAAAGTATTACGGGG - Intronic
1136174579 16:28508050-28508072 AGGAGGCAGAGAGCAGGAAGGGG - Intronic
1136341978 16:29649994-29650016 AGGAGGCAGAATGGATGATGGGG + Intergenic
1137685606 16:50384845-50384867 AGGGGGCAGGAAGAATGAGGGGG - Intergenic
1139476039 16:67203025-67203047 AGGGGGCAGAGGGCAGGCAGAGG + Intronic
1139530205 16:67538912-67538934 AGGGTGCAGACAGCAGGGAGAGG - Intronic
1139692475 16:68650065-68650087 AGGGGGTAGTTAGCATGGAGAGG + Intronic
1140692417 16:77497188-77497210 TGGGAGCAGAAAGAATGCAGAGG - Intergenic
1141360850 16:83393872-83393894 AGAGAGAAGCAAGCATGAAGAGG + Intronic
1141637340 16:85321342-85321364 AGAGGGGAGAAACCATGGAGTGG - Intergenic
1141901018 16:86990571-86990593 AGGAGAGAGAGAGCATGAAGCGG + Intergenic
1142336902 16:89495233-89495255 AGGAAGCAGAAAGAATGCAGGGG - Intronic
1143629310 17:8128461-8128483 TGGGGAGAGAAAACATGAAGGGG + Intergenic
1145179701 17:20736295-20736317 AGGGGAAAGAAAGAATGTAGTGG + Intergenic
1146279606 17:31536713-31536735 ATGGGGCAGCCAGCAGGAAGCGG + Exonic
1146692934 17:34889236-34889258 GGGTGGCAGGAAGCATGAGGAGG - Intergenic
1146697977 17:34926071-34926093 AGGGTGGAAAAAGCATGATGGGG + Intergenic
1147446364 17:40477585-40477607 AGGACGCAGAAAGGATGTAGGGG - Exonic
1147646247 17:42035910-42035932 AGGGGGCAGGGAGCAGCAAGTGG + Intronic
1147724014 17:42555250-42555272 AGGGTGCAGTGAGCATGATGGGG + Intergenic
1148553899 17:48566441-48566463 AGAGGGCTGAAAGAATAAAGAGG + Intronic
1148854285 17:50570272-50570294 AGGGGGCGGGAAGGAGGAAGGGG - Intronic
1149192983 17:54086114-54086136 AGAGGCCTGGAAGCATGAAGCGG + Intergenic
1150041162 17:61863140-61863162 ACGGGGCAGAAAACCTGAGGAGG - Intronic
1150321860 17:64221200-64221222 AGGGGGCAGGGGGCAGGAAGAGG + Intronic
1151485048 17:74393794-74393816 AGGGGGAGGAAAGCAGAAAGAGG + Intergenic
1151775515 17:76198595-76198617 AGGCTGCAGAAGGAATGAAGAGG - Intronic
1151886708 17:76926925-76926947 GGGGAGCAGGAAGCATGGAGGGG + Intronic
1153079212 18:1201494-1201516 AGGGGGAAGAAGGAAAGAAGAGG - Intergenic
1153321158 18:3775434-3775456 AGTAGGAAGAAAGAATGAAGGGG - Intronic
1153458963 18:5312791-5312813 AGAGGGGAGAAAGCAGTAAGAGG - Intergenic
1153774021 18:8437189-8437211 AGGTGGCAGCCAGAATGAAGAGG - Intergenic
1154336070 18:13465877-13465899 AAGGGGGAGAGAGTATGAAGAGG - Intronic
1154475215 18:14748406-14748428 AGGGGGCTGCAGCCATGAAGAGG + Exonic
1155408123 18:25512653-25512675 AGGGGTCAGTAGGCAAGAAGAGG + Intergenic
1156016883 18:32556420-32556442 AGGAGAAAGAAAGCGTGAAGGGG - Intergenic
1157721983 18:49932191-49932213 AGAGGTCAGGAAGCATGATGTGG - Intronic
1157928326 18:51790926-51790948 AGGGGGCTGTAAGCAAGCAGGGG + Intergenic
1158129869 18:54140498-54140520 AGGAGAGAGAGAGCATGAAGAGG - Intergenic
1160735690 19:661403-661425 TGGGGACAGAAAGCTGGAAGAGG + Intronic
1161579347 19:5072169-5072191 AGGGGGAAGAGAGCATGTGGCGG - Intronic
1161709180 19:5838303-5838325 CGGGGCCAGGAAGGATGAAGGGG + Intronic
1162605676 19:11705848-11705870 TGGGGGGAGAAAGGATAAAGGGG - Intergenic
1162669650 19:12244757-12244779 AGGAGGCAGAAAGAATAGAGTGG - Intronic
1163174200 19:15552697-15552719 TGGGGGCAGAATGAAGGAAGGGG + Intergenic
1163686483 19:18714800-18714822 AGGGTGCAGACAGCAGGATGTGG - Intronic
1165075627 19:33278631-33278653 AGGGGACAGACAGCAGAAAGAGG - Intergenic
1166326496 19:42054112-42054134 ATGGGACAAAAGGCATGAAGAGG + Intronic
1167573455 19:50305311-50305333 AGGGGGCAGAAGGAATGAAGCGG + Intronic
1167632528 19:50634346-50634368 AGGGGACACACAGCAGGAAGGGG + Intronic
1168278346 19:55289444-55289466 AGGGGGCAGAGGGCTGGAAGGGG - Intronic
925077200 2:1026823-1026845 AGGAGGCAAAGAGCAGGAAGAGG - Intronic
925810248 2:7693403-7693425 CTAGGGCAGAAAGCAAGAAGTGG - Intergenic
926599276 2:14824467-14824489 AGGGGACAGAAAGAAAGAAAGGG + Intergenic
926644953 2:15280400-15280422 AGGGGGAAGAGAGAATAAAGAGG + Intronic
927392102 2:22607180-22607202 AGGAGGCAGTATGCATGAAGAGG - Intergenic
927927610 2:27024667-27024689 AGGGGGCAGGGGGCAAGAAGGGG - Intronic
928442668 2:31305058-31305080 AGGGGCCAGAAATCAAGAAGTGG + Intergenic
929713151 2:44285023-44285045 AGGGGAAAGAAACCATAAAGAGG - Intronic
930206307 2:48589496-48589518 GTGGGGCAGAAAGTCTGAAGAGG + Intronic
931184143 2:59933327-59933349 TGAGGACAGAAAGCATGAAGGGG - Intergenic
932586232 2:73031273-73031295 AGGGGACAGAAAGCATGGAGGGG - Intronic
933420761 2:82042940-82042962 AGAGGCCAGAAAGCAGGAACAGG - Intergenic
933789557 2:85873010-85873032 TGTGGGCAGACAGAATGAAGGGG + Intronic
934055276 2:88246315-88246337 AGGGGAGAGAAGGCAGGAAGGGG + Intergenic
935794482 2:106628158-106628180 TGGGGGCAAGAAGCAAGAAGGGG - Intergenic
935810559 2:106793173-106793195 AGGAGACAGAAAGAGTGAAGAGG + Intergenic
935869754 2:107433812-107433834 AGGGGTCCGAAAAGATGAAGTGG + Intergenic
936937409 2:117851624-117851646 AGGGAGCAGGAAGGATGAGGTGG + Intergenic
937419017 2:121739236-121739258 AGGGAGGAGAAAGCAGAAAGGGG + Intronic
938398252 2:130966156-130966178 TGGGGGCAGAGAGGATGAAGAGG - Intronic
938624225 2:133091060-133091082 AGGAGGAAGAGAGCATGAATGGG - Intronic
939177891 2:138771418-138771440 AGGTGGCAGAAAGCAGGCAGGGG + Intronic
939541020 2:143493632-143493654 AGGGGGAAAAAAGCAAGGAGTGG - Intronic
940823506 2:158384503-158384525 AGGAGGAAGAAAGAATGAACGGG - Intronic
941471711 2:165896552-165896574 AAGGGACAGAGAGCAAGAAGTGG + Intronic
941703588 2:168633409-168633431 AGGAGGCAGAAATCCAGAAGAGG + Intronic
941734205 2:168955434-168955456 AGGAGGAAGAAAGAGTGAAGGGG + Intronic
942111553 2:172687852-172687874 AGTGGGCAGCAGGCAAGAAGAGG - Intergenic
942602679 2:177657668-177657690 AGGGGAGAGAAAGCAGAAAGAGG + Intronic
942778057 2:179608310-179608332 GGGGTGCAGAAACCATGCAGTGG + Intronic
942881959 2:180871737-180871759 AAGGGGAAGAAAGAATGAGGAGG + Intergenic
943470784 2:188291966-188291988 AGGGGGGAGAGAGCGCGAAGAGG + Intronic
943655913 2:190508877-190508899 AGGGGCTAGTAAGCATGAACAGG - Exonic
945921506 2:215759848-215759870 AGTCTGCAGAAAGCATGGAGAGG + Intergenic
946163931 2:217852395-217852417 AGGAGGCACAAAGGATGGAGGGG - Intronic
946174011 2:217911756-217911778 AGAGGGGAGATAGCATGATGGGG - Intronic
947148284 2:227088426-227088448 AGGTGACAGAGAGCATGAACAGG - Intronic
947268699 2:228308895-228308917 AGGGGGAAGAAAAGAAGAAGAGG + Intergenic
947282408 2:228469977-228469999 ACAGGGCAGAAAGCAAGAGGTGG - Intergenic
948030003 2:234809637-234809659 TGGGGGCAGAAAGAAACAAGAGG - Intergenic
948825513 2:240571845-240571867 AGGGGACAGCAAGCAGGGAGTGG - Intronic
1168831312 20:846637-846659 AGGGGGCAGGAAGCTCGGAGAGG + Intronic
1168923286 20:1558674-1558696 AGGAGGCAGAAGTCATGAGGAGG - Exonic
1169457007 20:5760775-5760797 AGAGTGGAGAAAACATGAAGTGG + Intronic
1169522998 20:6393177-6393199 AGCAGGCAGAAAACATGAACAGG - Intergenic
1170606099 20:17876031-17876053 AGGGGGAAGCAGGCATGAGGAGG + Intergenic
1171392849 20:24812212-24812234 ATGGGGCAGGCAGCATCAAGAGG - Intergenic
1171936073 20:31276591-31276613 AAGGGGAAGAAAGCATCAAAGGG - Intergenic
1172870846 20:38134693-38134715 AGGGAGGAGAGAGCATGAAAGGG + Intronic
1173402712 20:42739359-42739381 AGGGGGAAGAGAGGAGGAAGAGG + Intronic
1173486973 20:43448291-43448313 AGAGGGGAGAAAGCAGGGAGAGG + Intergenic
1173787199 20:45802794-45802816 AGGGGGAAGGAAGGATGAACAGG - Intronic
1173908613 20:46647338-46647360 AGGGGGCATAAGGCAGGAAAGGG + Intronic
1174268273 20:49347790-49347812 AAGGGGCAGAAAGGGTGATGAGG + Intergenic
1174285920 20:49473499-49473521 AAGGGACAGAAAGTAGGAAGGGG + Intronic
1174446775 20:50596043-50596065 AGGTGGTGGGAAGCATGAAGGGG - Intronic
1174495297 20:50937118-50937140 AGAGGGGAGAAAGCAAGAAGAGG + Intronic
1174542519 20:51300841-51300863 AGGGGATATAAAGCAGGAAGTGG + Intergenic
1175954599 20:62602869-62602891 AGGGGGCAGAACCCCAGAAGGGG - Intergenic
1177306270 21:19320980-19321002 AGGGGAAAGAAAGAAGGAAGAGG + Intergenic
1177555380 21:22681648-22681670 AGAGGGAAGAAAACATGAAAAGG + Intergenic
1177776544 21:25573891-25573913 AGGTGGCACAAACCAGGAAGGGG + Intergenic
1178322020 21:31613092-31613114 AGGAGGAAGAAAGCATAAGGAGG - Intergenic
1178640061 21:34338216-34338238 AGGGGGCAGATAGGCTGATGGGG + Intergenic
1178829481 21:36043881-36043903 ACGTTGGAGAAAGCATGAAGAGG - Exonic
1179592480 21:42418297-42418319 GAGGGGCAGAAAGCAGGAGGTGG + Intronic
1179959610 21:44760684-44760706 AGGGGGGAGGAAACAAGAAGTGG + Intergenic
1180008652 21:45035114-45035136 AGGGGAAAGAGAGCATGGAGGGG + Intergenic
1180475065 22:15696367-15696389 AGAGGGAAGAGACCATGAAGAGG + Intronic
1182024000 22:27103039-27103061 AGGGGGCAGGGAGGATGGAGGGG + Intergenic
1182282034 22:29223453-29223475 TGGAAGCAGAAAGAATGAAGAGG + Intronic
1183143801 22:35970713-35970735 AAGGGACACAAAGTATGAAGAGG + Intronic
1183763759 22:39850594-39850616 AAAGGGCAAAAAGCATAAAGTGG - Intronic
1184238165 22:43197611-43197633 GGGTGGCAGAAAGCAGGAGGAGG - Exonic
1184256204 22:43288502-43288524 AAGGAGCAGAGAGCACGAAGCGG - Intronic
1184383109 22:44158706-44158728 AGAGGGCAGACAGCAGGGAGAGG - Intronic
1184474677 22:44714123-44714145 CAGGGGCAGGAAGCATGAGGGGG + Intronic
1184990899 22:48169360-48169382 AGGGGACAGAATAGATGAAGGGG + Intergenic
949549877 3:5104085-5104107 AGGGGGGAGGAAGAAGGAAGAGG - Intergenic
950239504 3:11355540-11355562 AGGGGGAAAAAAGCTTGAACAGG + Intronic
950581905 3:13867773-13867795 AATGGGGAAAAAGCATGAAGAGG + Intronic
950886433 3:16366618-16366640 AGGTGGCAGGAAGAAAGAAGGGG - Intronic
951062226 3:18222755-18222777 GGGTGGAAGACAGCATGAAGAGG - Intronic
951740975 3:25923148-25923170 AGGGGACAGAAAGAATGATTTGG - Intergenic
951857416 3:27213287-27213309 AGGGGGAATAAAGAAAGAAGGGG + Intronic
952167446 3:30766190-30766212 ATGGGGCACCAAGAATGAAGAGG + Intronic
952224172 3:31357208-31357230 AGTGGGGAGAAAGCATAAAATGG + Intergenic
952511064 3:34056440-34056462 GGGGGTCAGGAAGCAAGAAGAGG - Intergenic
953127607 3:40106868-40106890 AAAGGCCAGAAAGCATCAAGTGG - Intronic
953242965 3:41165950-41165972 AAGGGGCAGAAGGCAGAAAGGGG + Intergenic
953564644 3:44021415-44021437 AGGAGGGAGAAAGGAGGAAGGGG - Intergenic
956316921 3:67948282-67948304 AGAGGCCAGGAAGCATGAAATGG + Intergenic
957336306 3:78833571-78833593 TGGGGGCAGAGAGAAAGAAGGGG + Intronic
957547959 3:81664139-81664161 TAGGGGCAGAGAGGATGAAGAGG + Intronic
958467967 3:94481822-94481844 AGCTGGCAGAAAGCATTAATAGG - Intergenic
958472173 3:94534471-94534493 ACATGGCAGAAAGAATGAAGGGG - Intergenic
958658730 3:97038295-97038317 TGGGGGGGGAAAGGATGAAGAGG - Intronic
959116211 3:102181770-102181792 AGGAGGCACACAGCAGGAAGTGG + Intronic
959406159 3:105963789-105963811 AGCTGGCAGAAAGCATCAAAGGG + Intergenic
960504873 3:118480014-118480036 AGGAGGCTGAAGGCAGGAAGGGG + Intergenic
960966765 3:123110982-123111004 AGGGGGCATAAAACATGATCAGG - Exonic
961133746 3:124491648-124491670 AGAGGGAAGAAAGCAGGGAGTGG + Intronic
961136147 3:124513183-124513205 AGGGGGCTGGGAGCAGGAAGGGG + Intronic
961476124 3:127147422-127147444 AGGGGGCAGAAGGAATGAGAAGG + Intergenic
961901798 3:130220172-130220194 AGTGGGGAGAAAGCCTGAAAGGG + Intergenic
962428641 3:135298586-135298608 TGGGGGCTCAAAGCAAGAAGAGG + Intergenic
965534090 3:169806482-169806504 AGGGGGTAGAAAAGATGGAGAGG + Intronic
965856731 3:173098274-173098296 AAGGGGCTGAAAGAATGAGGTGG - Intronic
966022468 3:175232273-175232295 AGTGGGAAGAAAGCATGAATAGG + Intronic
966234123 3:177681935-177681957 CAGGAGCAGATAGCATGAAGAGG - Intergenic
966498796 3:180612913-180612935 AGTGAGCAGAAAACATGAATAGG + Intronic
967076162 3:186004441-186004463 AGGAAGAAGGAAGCATGAAGGGG + Intergenic
967396715 3:189016736-189016758 AGGAGAAAGAGAGCATGAAGGGG - Intronic
968025847 3:195442388-195442410 AGGGGGTGGAAACCAAGAAGGGG + Intronic
968704217 4:2070471-2070493 AGGGGGCAGGAAGCACCAAGAGG + Intergenic
968995393 4:3942124-3942146 GGGGAGCATACAGCATGAAGAGG + Intergenic
969282172 4:6178078-6178100 CGGGGACAGGAAGCATGAAGTGG - Intronic
969688295 4:8689193-8689215 AGGTGGAGGAAAGCATGGAGGGG + Intergenic
970854551 4:20636917-20636939 AGGGGGAAGAAAGTACGAGGTGG + Intergenic
971035220 4:22685561-22685583 AGGTGGCAGGAAGCAGGAGGAGG + Intergenic
972458007 4:39272910-39272932 TGGGGGAACAAAGCATGAATTGG + Intronic
973749074 4:53994493-53994515 AGGAGGAAGAGAGAATGAAGGGG - Intronic
975248961 4:72154713-72154735 TGAGGGCAAAAACCATGAAGAGG - Intergenic
975494478 4:75022927-75022949 AGGGGGAACAAAGCATGCTGAGG - Intronic
975745420 4:77470409-77470431 AAGGGGGAGAAAGCAGGATGGGG - Intergenic
975765325 4:77661542-77661564 TGGGGAATGAAAGCATGAAGGGG + Intergenic
975929581 4:79503292-79503314 AGGGGGCAAAAGACATGAACAGG + Intergenic
976471454 4:85433947-85433969 TGGTGGCAGAAAGAATGAATTGG + Intergenic
977899798 4:102406932-102406954 AGGAAGCAGAAAGCAGAAAGTGG - Intronic
978346750 4:107777974-107777996 AGGGGGAAGAAAGGAAAAAGGGG + Intergenic
979276338 4:118818312-118818334 AGGGGGCAGAAGGCAAGACATGG - Intronic
979666175 4:123313202-123313224 AGGGGGCGGAATGGATGCAGAGG - Intronic
979866434 4:125760660-125760682 GGTGGGCAGAAGGCATCAAGGGG + Intergenic
979889507 4:126073447-126073469 AGGGGACAGTAAGCATAAAAGGG - Intergenic
980089082 4:128422904-128422926 AGGGGGCAAAGAACATGAACTGG - Intergenic
980806548 4:137822637-137822659 AGCGGGCAGAAAGCTGGCAGAGG - Intergenic
980860814 4:138497361-138497383 AGAGGGCAGAAGACATGAATAGG - Intergenic
981354310 4:143769586-143769608 AGTGGGCAGAAGACATGAACCGG - Intergenic
982114453 4:152086122-152086144 AAAGGGGAGAAAGCACGAAGGGG - Intergenic
982276340 4:153640137-153640159 AGGGAGCAGAAGCCATGAAGGGG + Intergenic
983696348 4:170537205-170537227 AGGAGACAGAAAGAATAAAGTGG - Intergenic
983775182 4:171597806-171597828 AAGGGGAAGAAAGAAAGAAGAGG + Intergenic
985873493 5:2577555-2577577 AGGGAGCCGAAAGCAGGGAGTGG - Intergenic
985937445 5:3107697-3107719 AGGTGGCTGAAACCCTGAAGAGG - Intergenic
986253984 5:6086534-6086556 AGGGGGCAGGAGGCATGTATAGG - Intergenic
986689975 5:10306361-10306383 AGGGGGCAGAGAGGAGGAGGAGG + Intronic
986781756 5:11072886-11072908 AGGAGGCAGACAGCAGGGAGGGG - Intronic
987367019 5:17157954-17157976 ATGGGGAAGAAGGCATGAAAAGG + Intronic
987488053 5:18544780-18544802 AGGAGGCAGAAAGCAGAAGGAGG - Intergenic
988035705 5:25824760-25824782 AGGGCACAGAAAACATGATGGGG - Intergenic
988676839 5:33441219-33441241 GGGGGGCAGGAAGCAGGAAGCGG + Intronic
989317910 5:40103764-40103786 AGGGGAGAGAATGCATGAATAGG - Intergenic
989776817 5:45219058-45219080 AGAGGGCAGGAAGGATGAATGGG + Intergenic
990504785 5:56433546-56433568 AGGGGGCACCAGGCAAGAAGAGG + Intergenic
991584826 5:68191231-68191253 AGGGGGCAGGAGGCAGGGAGAGG - Intronic
992562551 5:77966882-77966904 AGGAGAGAGAAAGCATGCAGGGG + Intergenic
993526517 5:88972181-88972203 TGGGGGCAGAAGGCTGGAAGAGG + Intergenic
994712681 5:103284258-103284280 AGGGGAAAGAAAGCAGCAAGTGG + Intergenic
996043254 5:118841053-118841075 AAGGAGCATAAAGCTTGAAGAGG + Exonic
996302929 5:122009424-122009446 AGTAGGCAGAAAACATGAAAAGG - Intronic
996788616 5:127268581-127268603 AGGGGCCAGGAAGCTTGAACTGG + Intergenic
996868462 5:128157492-128157514 AGAGGGCTGATATCATGAAGTGG + Intronic
998093783 5:139385499-139385521 GGGGTGCAGATAGCATGGAGTGG + Intergenic
999217626 5:149948555-149948577 AGGGCACAGCAAGAATGAAGAGG - Intergenic
999258271 5:150222073-150222095 AGGAAGCAGAAAGCAAGTAGGGG + Intronic
999933939 5:156464709-156464731 GGGGAAGAGAAAGCATGAAGAGG - Intronic
1000921494 5:167143579-167143601 AGAGGGGAAAAAGCATGAAGTGG + Intergenic
1001303562 5:170555298-170555320 TGGGGGCAGAAGGAATGAGGTGG + Intronic
1001476414 5:172054155-172054177 AGGGGCCAGGAAGCTTGAAGAGG + Intronic
1004158410 6:13191421-13191443 AGGAGGCAGAAAGCAAGGAGAGG + Intronic
1004527324 6:16421454-16421476 AGGAGACAGAAAGCATGGAAAGG + Intronic
1007938066 6:45751555-45751577 AGGGGGCAGAAAACAAGAAAAGG - Intergenic
1010695573 6:78970131-78970153 AGTTGGCATAAAGTATGAAGTGG - Exonic
1010703859 6:79083986-79084008 AGAGGAAAGAAAGCAGGAAGAGG - Intergenic
1011153412 6:84300784-84300806 AGGAGGGAGAGAGCGTGAAGGGG - Intergenic
1012520252 6:100112758-100112780 AGTGGGTAAGAAGCATGAAGTGG + Intergenic
1012808386 6:103925544-103925566 AGGAGGCAAACAGCATGAAGTGG + Intergenic
1013341619 6:109221299-109221321 AGGGGGCAGAGAACAATAAGTGG + Intergenic
1013427240 6:110023943-110023965 AGGAGGCAGAGGGGATGAAGAGG - Intergenic
1013658148 6:112266611-112266633 AGGGGGCAGGAAGTAGGAGGGGG + Intergenic
1014068388 6:117152856-117152878 AGGAGAGAGAGAGCATGAAGGGG + Intergenic
1014467678 6:121776607-121776629 ATGGGGAAGAAAGAAGGAAGGGG - Intergenic
1014804860 6:125818069-125818091 AGGTGGGAGAAAGAAGGAAGGGG - Intronic
1015035443 6:128648175-128648197 AGAGGGCAGAATACCTGAAGTGG - Intergenic
1015556922 6:134472229-134472251 AGGGGGCAGAAAGATTGTTGGGG - Intergenic
1015952862 6:138571616-138571638 TGGGGGCAAAAATCATGAAGGGG + Intronic
1016048679 6:139506728-139506750 TGGTGGCAGTAGGCATGAAGAGG - Intergenic
1016281159 6:142420482-142420504 AGGGGACAGGATGTATGAAGAGG - Intronic
1017020502 6:150136278-150136300 ATGAGGCAGAAAGGATGAAAGGG + Intergenic
1017700977 6:157071207-157071229 AGGATGCAGAAGGCAAGAAGAGG + Intronic
1017927737 6:158924726-158924748 AGGGGGAAGAGAGAAGGAAGGGG + Intergenic
1018871486 6:167787001-167787023 AGAAAGCAGAAAGTATGAAGAGG - Intronic
1019511590 7:1420197-1420219 AGGGGGCAGAAAGGATGACTCGG + Intergenic
1019754613 7:2759906-2759928 AGGTGGCAGAAAGCAGGGAGCGG - Intronic
1021397909 7:20172982-20173004 AGGAGGTAGAAAGCAAGAACAGG - Intronic
1022070613 7:26909942-26909964 TGGGGGCAGATAGCTTCAAGAGG + Intronic
1022728115 7:32998789-32998811 TGGGGCCAGGAAGCATGCAGGGG + Intronic
1022824748 7:33997483-33997505 AGGAGAGAGAGAGCATGAAGAGG - Intronic
1022981252 7:35606845-35606867 AGGTCGCAGAAAGAATTAAGTGG - Intergenic
1025045540 7:55689230-55689252 TGGGGCCAGGAAGCATGCAGGGG - Intergenic
1025118101 7:56275755-56275777 GGGGGACAGAAAGTATGAGGTGG + Intergenic
1026606007 7:71816408-71816430 ACCTGGCAGAATGCATGAAGAGG + Intronic
1027266437 7:76497558-76497580 AGGGAGCAGAGAGAAGGAAGAGG - Intronic
1027317818 7:76995676-76995698 AGGGAGCAGAGAGAAGGAAGAGG - Intergenic
1028719950 7:94018367-94018389 AGGGGGCAGAAAACTTAAACAGG - Intergenic
1028748830 7:94359069-94359091 AGTGGGCAAAAAACATGAACAGG + Intergenic
1030423085 7:109333859-109333881 AGGGGGAAGAAAGCAGGAAGAGG - Intergenic
1030996623 7:116367382-116367404 AGGAGGCAGAAGGAATGAGGAGG + Intronic
1031304696 7:120111847-120111869 AGTGGGCAAAAAACATGAATAGG - Intergenic
1031633644 7:124075178-124075200 AAGGGGAAGAAAACAAGAAGGGG - Intergenic
1032265862 7:130369415-130369437 AGGCAGCAGACAGAATGAAGAGG - Intergenic
1032836734 7:135681895-135681917 AGAGTGCTGTAAGCATGAAGTGG - Intronic
1033200326 7:139362787-139362809 AGGGGGAAGAAACCTTGAGGGGG - Intronic
1033903105 7:146167494-146167516 ATGTAGCAGAAAGGATGAAGAGG + Intronic
1034135510 7:148764449-148764471 AGGGGGCAGGAAGAGTGAACAGG - Intronic
1034535037 7:151721062-151721084 AGGGGGCAGAGGGGATGGAGGGG + Intronic
1035262588 7:157671373-157671395 AGGCGGCAGAAGGGATAAAGGGG + Intronic
1035297299 7:157874376-157874398 AGGGGGCAGAAAGCAGGAGCTGG - Intronic
1035555595 8:564995-565017 AGGGAGCAGAAAACCTGAAAAGG - Intergenic
1037094251 8:14964547-14964569 AGAGGACAGAAAGCAGGATGGGG + Intronic
1037806059 8:22058448-22058470 AGGATGCAGAAAGCAGAAAGCGG + Intronic
1038981338 8:32762826-32762848 TGGGGGAAGAAAGCATGGTGTGG + Intronic
1039323249 8:36456355-36456377 AGGGGGAAGAAAGAAAGAAAAGG - Intergenic
1040730182 8:50435595-50435617 AGGCAGCAGGAAGCATGAAAAGG - Intronic
1041800445 8:61792228-61792250 AGGGAGCAGATGGCATGCAGTGG + Intergenic
1044477072 8:92639516-92639538 AAGGAGCAGAATGTATGAAGAGG + Intergenic
1044524344 8:93234756-93234778 AGGGGGAAAAAAGCATGGTGTGG + Intergenic
1045336773 8:101211752-101211774 AAGGGGCAGCAAGCATGAGTGGG + Intergenic
1047304992 8:123645492-123645514 AGGGGAGAGAAAGAAAGAAGGGG + Intergenic
1048116556 8:131530786-131530808 AGGGGAAGGAAAGCATGAAAGGG - Intergenic
1049258273 8:141625340-141625362 AGGGGACCGGAAGCATGAGGTGG - Intergenic
1049504673 8:142989691-142989713 AGAGGGCAGAATGGATGTAGTGG + Intergenic
1050270993 9:3944932-3944954 AGGGGGCAGAACACAAGAGGTGG + Intronic
1050801412 9:9619339-9619361 AGAAGGGAGAAAGTATGAAGAGG + Intronic
1053148396 9:35727552-35727574 AGGGGGCAGAGAGCTGGAACTGG - Intronic
1054842071 9:69753722-69753744 AGGGGGAAAAACACATGAAGAGG + Intronic
1055661276 9:78506456-78506478 AAGGGGAAGAAAACAGGAAGAGG + Intergenic
1057067951 9:92072937-92072959 TGGGGGGAGAAAGATTGAAGGGG - Intronic
1057734165 9:97638246-97638268 AGGAGGCAGAAAGTATTAAGAGG - Intronic
1058240646 9:102553564-102553586 AGTGGGCAAAAAACATGAACAGG - Intergenic
1059791571 9:117646377-117646399 AGGGGGCAGAAAAGAGGGAGTGG - Intergenic
1059920893 9:119158650-119158672 AGGGGGCCAAAGGCCTGAAGGGG - Intronic
1060253036 9:122001499-122001521 AGGGGGTGGGAATCATGAAGGGG + Intronic
1060444907 9:123679093-123679115 AGGGGGGAAAAGGCAAGAAGGGG + Intronic
1061706757 9:132458870-132458892 AGGGTGAAAAAAGCATGAAATGG + Intronic
1062097903 9:134712239-134712261 AGGGGGGAGGAAGGAAGAAGGGG - Intronic
1062174270 9:135152334-135152356 AAGGGGCAGAAAGCAGCAGGGGG - Intergenic
1062262998 9:135672122-135672144 AGGGGCCAGGAGGCAGGAAGTGG - Intergenic
1062669733 9:137701030-137701052 AGGAGAGAGAAAGCATGAAGGGG + Intronic
1186059953 X:5694182-5694204 ATGGGGCAGGGAGGATGAAGAGG - Intergenic
1187127948 X:16471290-16471312 AGGGAGCAGAAAGCAGGATCGGG + Intergenic
1188222687 X:27559794-27559816 AGTGGGCATAAAGTATGAATTGG - Intergenic
1189027581 X:37413301-37413323 AGTGGGCAGGAGGCATGAATAGG - Intronic
1189122029 X:38405112-38405134 AGGGAGCAGAAGCCATGAAAAGG + Intronic
1189125134 X:38437770-38437792 AGGGGCCAGAAGGCAAGAAGAGG + Intronic
1190476226 X:50830478-50830500 AGCTGGCAGACAACATGAAGAGG - Intergenic
1190506956 X:51135880-51135902 AGGAAGAAGAGAGCATGAAGGGG - Intergenic
1190878312 X:54475129-54475151 AGGAGGCAGAGAGAATGGAGAGG - Intronic
1191021466 X:55865294-55865316 AGTGGGCAAAAAACATGAATAGG + Intergenic
1191181178 X:57565401-57565423 AGAGGCCAGGAAGCATGAACTGG + Intergenic
1192225239 X:69222920-69222942 TGGGGGTAGGAAGCAGGAAGAGG - Intergenic
1192654757 X:72981173-72981195 AGAGGCCAGGAAGCATGAACTGG + Intergenic
1193974236 X:88098040-88098062 GGGAGGCACAAAGCATGTAGTGG + Intergenic
1194721553 X:97346390-97346412 AGGGAGAAGAGAGGATGAAGGGG - Intronic
1195016841 X:100789215-100789237 AGGGGGCAGGAAGTGTGAGGAGG + Intergenic
1195828115 X:109024985-109025007 AGAGGCCAGGAAGCATGAATTGG - Intergenic
1195906663 X:109851098-109851120 AGGGGGAAGAAAGCATGAAAAGG - Intergenic
1196027460 X:111055940-111055962 AAGGGGCAGAAAGAGGGAAGAGG - Intronic
1196173174 X:112612199-112612221 AGGTGGCAGAAAGGAGGATGAGG - Intergenic
1197315063 X:124955520-124955542 AGTGGGCAGAAGCAATGAAGTGG - Intronic
1197469143 X:126846352-126846374 AGGGGGTGGAAAGCAAGAAGGGG + Intergenic
1197745306 X:129928794-129928816 AGGAGACTGAAAGCATAAAGAGG + Intronic
1198169280 X:134089953-134089975 AGGGAGCAAAAAGCAGGAGGAGG + Intergenic
1198265490 X:135004640-135004662 AGGGGGCACACAACAGGAAGGGG + Intergenic
1198741671 X:139849589-139849611 AGAGGGCTGAAAGAGTGAAGAGG - Intronic
1199161151 X:144613818-144613840 AGGTGGCAGGAAGGATGTAGAGG - Intergenic
1199340232 X:146669038-146669060 AGGGTGGAGAATTCATGAAGGGG - Intergenic
1199519005 X:148713751-148713773 ATTGGGAAGAAAGCAGGAAGAGG + Intronic
1199741387 X:150739507-150739529 AGGGGAGAGAAAGCTTGAATGGG + Intronic
1199938858 X:152604514-152604536 TGGGGGCAGAAGGCATCACGTGG + Intergenic
1201778048 Y:17687956-17687978 AGGGGAGAGAGAGCATGAAAGGG - Intergenic
1201823510 Y:18218036-18218058 AGGGGAGAGAGAGCATGAAAGGG + Intergenic
1202602942 Y:26613058-26613080 AGGGAGCAGAAAGCAGGGTGTGG + Intergenic