ID: 1065110398

View in Genome Browser
Species Human (GRCh38)
Location 10:22435619-22435641
Sequence AGGGGGCAGAAAGCATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110398_1065110411 26 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT No data
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110398_1065110410 25 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT No data
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110398_1065110409 24 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT No data
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data
1065110398_1065110412 27 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT No data
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data
1065110398_1065110406 -1 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT No data
Right 1065110406 10:22435641-22435663 TTTGGGGAAAGTATGCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110398 Original CRISPR AGGGGGCAGAAAGCATGAAG TGG (reversed) Intronic