ID: 1065110402

View in Genome Browser
Species Human (GRCh38)
Location 10:22435636-22435658
Sequence AGGCATACTTTCCCCAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110402_1065110409 7 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data
1065110402_1065110410 8 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110402_1065110412 10 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data
1065110402_1065110415 30 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110402_1065110411 9 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110402 Original CRISPR AGGCATACTTTCCCCAAAGG GGG (reversed) Intronic
900429196 1:2593927-2593949 GGGAATACTGTCCCCAAGGGCGG + Exonic
904907764 1:33910740-33910762 AGGCAGGCTTTCCCAAGAGGTGG - Intronic
906330128 1:44877460-44877482 AGGCCTCCTTTCCCAAGAGGTGG - Intronic
909100429 1:71342073-71342095 AGGCAGACTTGGCCCCAAGGTGG + Intergenic
910840867 1:91560218-91560240 AGACATGATTTCCCCTAAGGAGG - Intergenic
911948015 1:104136711-104136733 AGGCAGACTTGCCCCTGAGGTGG - Intergenic
917392936 1:174559050-174559072 AGGCATCCTTTCCAGAAAAGGGG + Intronic
918141012 1:181719950-181719972 AGGGATACTTTCCCCCTAAGGGG - Intronic
919615407 1:199802109-199802131 AAGCATATTTTCCTCAAAAGAGG + Intergenic
920074138 1:203324799-203324821 GGGCAGAGCTTCCCCAAAGGAGG + Intergenic
921129518 1:212207895-212207917 AGGCTTATTTTCCCAAGAGGGGG + Intergenic
922578327 1:226678353-226678375 AGACTTGCTTTCCCTAAAGGGGG + Intronic
922940569 1:229461388-229461410 AGAGATACTTTCCCTAAAGCAGG + Intronic
1065110402 10:22435636-22435658 AGGCATACTTTCCCCAAAGGGGG - Intronic
1068606877 10:59015188-59015210 AGCTATACTGTCACCAAAGGTGG + Intergenic
1071888786 10:89979945-89979967 AGGCTGACTTTCCTCAAAGAAGG + Intergenic
1079379259 11:19922712-19922734 AGGCATTCTTTTCTCAAAGCGGG - Intronic
1080380882 11:31771290-31771312 AGACAGAATTTCCCCAAAGGTGG - Intronic
1080755666 11:35195244-35195266 AGGCATTCTTTCTGCAGAGGGGG + Intronic
1081543830 11:44055676-44055698 AGGAATAGCTTCACCAAAGGTGG + Intronic
1081705058 11:45178027-45178049 AGTAATACTTTGCCCACAGGGGG + Intronic
1084882347 11:72180707-72180729 AAACATACTCTCCCCAAAGCAGG + Intergenic
1085266037 11:75238713-75238735 AGGCCTCATTTCCCCAAATGAGG + Intergenic
1085974581 11:81636795-81636817 AGGGTTTCTTTCCCCAAAGTGGG - Intergenic
1089694961 11:120211198-120211220 AGGCAAACTTCGCCCAAAGTTGG - Exonic
1091341826 11:134821909-134821931 AAGCATACCCTCCCCAGAGGTGG + Intergenic
1092067872 12:5607106-5607128 TGGAATTCTTTCCCCAAGGGAGG - Intronic
1093857592 12:24125169-24125191 GGCCAAACTTTCCCTAAAGGAGG + Intergenic
1094222405 12:28008667-28008689 AGGCTTTCTTTCCCCACAGAGGG - Intergenic
1095535535 12:43241828-43241850 TGGAATGCTTTCCACAAAGGTGG - Intergenic
1096447917 12:51711098-51711120 TATCATACTTTCCCCAAAAGAGG - Intronic
1099437356 12:82660020-82660042 AGGCAGACTTACCCCTGAGGTGG + Intergenic
1108094798 13:46890414-46890436 AGGCAGACTATCACCACAGGAGG - Intronic
1114847451 14:26340276-26340298 AGGAATCCATTCCCCACAGGGGG + Intergenic
1115336698 14:32249528-32249550 AGACAGACTTGCCCCTAAGGCGG + Intergenic
1117658845 14:57983888-57983910 AAGCTTGCTTTCCCCAGAGGTGG - Intergenic
1121721460 14:96111758-96111780 ATGAATATTTTCCCCAGAGGAGG - Intergenic
1125234861 15:37501355-37501377 AGGCACATTTTCCCCAAACCTGG - Intergenic
1127719524 15:61686171-61686193 AGGCAGCCTTTGCCCAAAGAGGG + Intergenic
1131340771 15:91598701-91598723 AGGCAGACAGTACCCAAAGGAGG + Intergenic
1131483118 15:92798899-92798921 AGGCAGACTTTATCCAAAAGGGG + Intronic
1135187212 16:20325508-20325530 AGGCTTTCTTTCCCCAAATGAGG - Intronic
1137604713 16:49779806-49779828 AGTCCTACTTTCTCCAAAGCTGG - Intronic
1138261907 16:55629840-55629862 AGGCAGACTTGCCCCTTAGGTGG - Intergenic
1138268603 16:55678617-55678639 AGGCACATGTTCACCAAAGGTGG - Intronic
1138620112 16:58204376-58204398 AGGCAGACTTTATCCAAATGAGG - Intergenic
1139024736 16:62801755-62801777 AGTCATACTGTCCCCAGTGGGGG + Intergenic
1141938357 16:87256968-87256990 AGGGATAGATTCCCCAAAGTGGG - Intronic
1146943448 17:36859356-36859378 AGGCATAATCTCCCCCAAGCAGG + Intergenic
1147042730 17:37730878-37730900 AGGTGTGCTTTCCCCCAAGGAGG + Intronic
1149376087 17:56045604-56045626 AGTAATACTTACCCCATAGGAGG - Intergenic
1150641790 17:66954233-66954255 GGTCACACTGTCCCCAAAGGTGG - Intergenic
1152195828 17:78917756-78917778 TGGCATCCTTTCCCCAGAGCTGG + Intronic
1152593743 17:81228180-81228202 AGGACTGCTTTCCTCAAAGGAGG - Intergenic
1155233273 18:23794456-23794478 GGGCATTCTTTCCCCACAGCTGG - Intronic
1160412406 18:78683843-78683865 AGGCACAGTTTCCCCACTGGTGG + Intergenic
1160661918 19:305273-305295 CGGCAAACTTTCAGCAAAGGAGG + Intergenic
1168725417 19:58578566-58578588 AGGTATCCTTTCCCTGAAGGAGG + Intergenic
926090894 2:10048491-10048513 AGGTAGACTTTTCCCGAAGGAGG + Exonic
927458715 2:23279060-23279082 AGGCCAACCTTCCCCAAATGAGG + Intergenic
927680693 2:25137206-25137228 AGGCATCCCCTCCCCAAGGGAGG + Intronic
929333770 2:40715168-40715190 AGGCATACTTTCACCCCAGAGGG - Intergenic
932739966 2:74283723-74283745 GGGCATAATTGCCCCCAAGGGGG + Intronic
933068681 2:77832003-77832025 AGGCAGACTTGCCCACAAGGTGG - Intergenic
934675498 2:96246859-96246881 AGGCCATCTCTCCCCAAAGGTGG - Intergenic
940112439 2:150169629-150169651 AGGAATACTTACAACAAAGGAGG - Intergenic
942643378 2:178084828-178084850 AGGTATACTTTCCCTGAAGGAGG - Intronic
942654144 2:178196761-178196783 AGGCATACATTCTCAAAAGAAGG + Intronic
943022849 2:182596381-182596403 AGACATACCTTCCCCCAGGGAGG + Intergenic
944093289 2:195938457-195938479 AGGCATACTTTTCCAGAAGGTGG - Intronic
947408563 2:229808430-229808452 AGGCAAACATTGCCCAAGGGGGG + Intronic
948382573 2:237561046-237561068 AGTCATACTTTCCCCAGGGAGGG + Intergenic
1170729601 20:18961853-18961875 AGGCATGCTTTTCCCAAATATGG + Intergenic
1171003349 20:21437713-21437735 AGACATAATTTCCCCAAAACAGG + Intergenic
1173638881 20:44585081-44585103 AGGCATCCTTTTTCCTAAGGTGG + Intronic
1174053635 20:47784347-47784369 AGGAAGACTTTCCAGAAAGGGGG + Intronic
1175083301 20:56438958-56438980 AGGCATAGTTACCCCAAGGAAGG + Intronic
1175201295 20:57279659-57279681 AGGCACCATTTCCCCAAAGCAGG + Intergenic
1178385940 21:32150625-32150647 TGTCATCCTTTCCCCAAAAGAGG - Intergenic
1178738936 21:35178517-35178539 AGGCACATTTTCCACAATGGTGG - Intronic
1182945118 22:34314709-34314731 AGGGATACTTTCCCCATACCAGG - Intergenic
1183739035 22:39659957-39659979 AGGCAACCTATCCCTAAAGGAGG + Intronic
1184306347 22:43605136-43605158 TGTCATACTTTCTGCAAAGGTGG - Intronic
950040759 3:9917724-9917746 AGGGATACTTACCCCAGAGGCGG - Exonic
951968073 3:28410985-28411007 AGGCAAACTTTCCCAAAATGGGG + Intronic
955055436 3:55451067-55451089 AGGGAAATTTTCCCCAAAGAAGG - Intergenic
956648313 3:71479065-71479087 AAGCAGACTATCCCAAAAGGGGG + Intronic
961046466 3:123712013-123712035 AGGAAAACTTCCCCCAAAGCAGG + Intronic
961628411 3:128279436-128279458 AGGGATAATTTCCCCCCAGGAGG - Intronic
961868096 3:129968621-129968643 AGGCTTACTGTCCTCAAAGATGG - Intergenic
963991473 3:151661294-151661316 AGGTCTACTTTCCCCAAAGAAGG + Intergenic
966932530 3:184685199-184685221 AGGTGTACTTTCCCCTAATGGGG + Intergenic
967771196 3:193335086-193335108 AGGTATACTTTCTCCTAAAGAGG + Exonic
968034756 3:195538053-195538075 AGGGATACTGACCTCAAAGGAGG - Intronic
968830081 4:2928750-2928772 AGACATGCTCTCCCCACAGGGGG + Exonic
969961358 4:10947762-10947784 AGGCAGTCTTGCCCCAAAGTCGG - Intergenic
970347829 4:15170562-15170584 AGGCAGACCTCCCCCAAAGCTGG - Intergenic
974086691 4:57268763-57268785 AGACATACTTTTCCCAAGGCCGG - Intergenic
974715908 4:65669252-65669274 GGGCCTCCATTCCCCAAAGGAGG + Intronic
976610833 4:87028889-87028911 AGGCGGATTGTCCCCAAAGGAGG + Intronic
977135939 4:93304434-93304456 AGCCATACTTTTCCTAAGGGGGG - Intronic
977407825 4:96622317-96622339 AAGAAGACTTTCCACAAAGGAGG - Intergenic
982570151 4:157039059-157039081 AGGCATGCATTCTCAAAAGGCGG - Intergenic
984022019 4:174497388-174497410 ATACATACTTTCCTTAAAGGTGG + Intronic
990111032 5:52325159-52325181 AGACATAAGTTCACCAAAGGTGG - Intergenic
990728312 5:58780804-58780826 AGCCATACTTCCTTCAAAGGAGG - Intronic
992370837 5:76142675-76142697 TGGCATGTTTTCCCCAAAGCAGG + Intronic
992905345 5:81340019-81340041 AATCATACTTTCCTCAAAGCCGG - Intronic
1000637352 5:163659445-163659467 AGGCCTCCTTTCCCCAAGGCTGG + Intergenic
1001081990 5:168674150-168674172 AGGCAGTATTTCCCCAAAAGTGG - Intronic
1010656516 6:78518116-78518138 AGGCATCCCTTCCCCAAGGTTGG + Intergenic
1017598784 6:156058965-156058987 AGCCATGCTTTCCCCAAAGGTGG - Intergenic
1018356980 6:163028073-163028095 ATGCATACTAACCCCAAAAGAGG + Intronic
1020315646 7:6903651-6903673 AGGAATACTTTACACACAGGTGG - Intergenic
1022260952 7:28704407-28704429 AGGTAGATTTTCCTCAAAGGTGG - Intronic
1024221794 7:47294574-47294596 AGGCAGACATGCCCCAATGGAGG - Intronic
1026460618 7:70611927-70611949 AGTCATAGTTTCTACAAAGGGGG + Intronic
1028532794 7:91856754-91856776 AGGCATATATTTACCAAAGGAGG + Intronic
1029632670 7:101762840-101762862 AGGCTGTCTCTCCCCAAAGGTGG - Intergenic
1042274108 8:66985493-66985515 GGGCATTGCTTCCCCAAAGGGGG - Intronic
1050426637 9:5518246-5518268 AACCATATTTTCCCCAGAGGAGG + Intronic
1051078973 9:13274669-13274691 AATCATATTTTCCCAAAAGGGGG + Intronic
1052858106 9:33419481-33419503 ACGCATACATTCTCCAAAGAAGG - Intergenic
1060219816 9:121758502-121758524 GAGCGTACTTTCCCTAAAGGCGG - Intronic
1186873506 X:13794918-13794940 AGGCATTCTTTCAAGAAAGGGGG - Intronic
1187912675 X:24125215-24125237 AGGCTTGCTTTCCCCAAGGCTGG + Intergenic
1188160118 X:26789937-26789959 ATACATAGTTTACCCAAAGGTGG + Intergenic
1189490778 X:41470187-41470209 AGGCATAATTTACTCAATGGGGG + Intronic
1191607495 X:63078544-63078566 AGGCGGACTTGCCCCCAAGGTGG - Intergenic
1191914727 X:66189171-66189193 AACCATACAGTCCCCAAAGGAGG + Intronic
1192064404 X:67865460-67865482 AGGCATACCTTCACCATTGGAGG - Intergenic
1194399051 X:93420647-93420669 AGGCAGACTTGCCCTCAAGGTGG + Intergenic
1197609058 X:128617963-128617985 AGCAATACTTTCCACAAAGTAGG - Intergenic
1201296468 Y:12467501-12467523 AGTCATAATTTTCACAAAGGTGG - Intergenic