ID: 1065110403

View in Genome Browser
Species Human (GRCh38)
Location 10:22435637-22435659
Sequence GAGGCATACTTTCCCCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110403_1065110409 6 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data
1065110403_1065110412 9 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data
1065110403_1065110410 7 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110403_1065110411 8 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110403_1065110415 29 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110403 Original CRISPR GAGGCATACTTTCCCCAAAG GGG (reversed) Intronic
902028144 1:13399713-13399735 AAGGCATACTTTCCTAAAAATGG - Intergenic
904047791 1:27619096-27619118 GAGGGCAGCTTTCCCCAAAGTGG + Intronic
905874344 1:41422592-41422614 GAGGGGTTCTTGCCCCAAAGTGG + Intergenic
909555877 1:76953472-76953494 GAGGAAACATTTCCCCAAAGAGG - Intronic
916952511 1:169795087-169795109 GAGACATACTTTCGTCAAACAGG - Intronic
919819225 1:201462403-201462425 GAGGCAAAGACTCCCCAAAGAGG + Intergenic
1063273644 10:4539687-4539709 GAGGTATACTCTGCCCAGAGTGG + Intergenic
1064263063 10:13801463-13801485 GAGGCAGACTTTCCCAAACCTGG + Intronic
1065110403 10:22435637-22435659 GAGGCATACTTTCCCCAAAGGGG - Intronic
1065963990 10:30755819-30755841 GAGGAGTTCTTCCCCCAAAGTGG - Intergenic
1067371756 10:45690457-45690479 GAGGCATACTTTCTCACAAGGGG + Intergenic
1067388025 10:45835692-45835714 GAGGCATACTTTCTCACAAGGGG - Intronic
1067418096 10:46121588-46121610 GAGGCATACTTTCTCACAAGGGG + Intergenic
1067446240 10:46348909-46348931 GAGGCATACTTTCTCATGAGGGG + Intergenic
1067503455 10:46828151-46828173 GAGGCATACTTTCTCACAAGGGG + Intergenic
1067591138 10:47511862-47511884 GAGGCATACTTTCTCATGAGGGG - Intronic
1067638256 10:48019954-48019976 GAGGCATACTTTCTCATGAGGGG - Intergenic
1067875238 10:50000407-50000429 GAGGCATACTTTCTCACAAGGGG + Intronic
1068562452 10:58530551-58530573 GAGACATTGTTACCCCAAAGTGG + Intronic
1070134861 10:73684380-73684402 GAGGCATACTTTCTCATGAGGGG - Intronic
1074510802 10:114110275-114110297 GAGACATACCTTCTCCAACGAGG - Intergenic
1079379260 11:19922713-19922735 AAGGCATTCTTTTCTCAAAGCGG - Intronic
1082241904 11:49882616-49882638 GAGGCAGAGTTTCCCCATATTGG + Intergenic
1085974582 11:81636796-81636818 GAGGGTTTCTTTCCCCAAAGTGG - Intergenic
1086460177 11:86998271-86998293 GATGCAAATTTTCCCCACAGAGG + Intergenic
1094222406 12:28008668-28008690 GAGGCTTTCTTTCCCCACAGAGG - Intergenic
1096646330 12:53038874-53038896 GTTTCATACTTTCTCCAAAGAGG - Intronic
1099973385 12:89523673-89523695 GTGGCATTCTGTCCCCAAACAGG - Exonic
1101545878 12:105712373-105712395 GAGGCAGGCTTTCCCCTAAAGGG - Intergenic
1106590387 13:31093503-31093525 GAGGCAGTGTTCCCCCAAAGGGG + Intergenic
1108678882 13:52762487-52762509 GAGGAATGCTTTCCCAGAAGAGG + Intergenic
1109762729 13:66850968-66850990 GAGGCAGAATTTCCTCAAGGAGG - Intronic
1109777074 13:67055146-67055168 GTGTAATATTTTCCCCAAAGGGG - Intronic
1112671645 13:101646166-101646188 GAAGCATACTGTCCTCAAAATGG - Intronic
1116214343 14:41991959-41991981 GAGAAATACTTTCCTCAGAGAGG + Intergenic
1119936330 14:78595499-78595521 GATGCAAACTCTCCCTAAAGAGG + Intronic
1122325557 14:100879185-100879207 GGGTCATGCTGTCCCCAAAGTGG - Intergenic
1127719523 15:61686170-61686192 CAGGCAGCCTTTGCCCAAAGAGG + Intergenic
1131818926 15:96251814-96251836 GTGGCTTATTTTCCCCAAACAGG + Intergenic
1131873898 15:96784774-96784796 GATGCATGCTGTCCCCAGAGTGG + Intronic
1136775606 16:32870265-32870287 CAGGCATACTCTCCCCACTGAGG - Intergenic
1136895011 16:33991247-33991269 CAGGCATACTCTCCCCACTGAGG + Intergenic
1141938358 16:87256969-87256991 TAGGGATAGATTCCCCAAAGTGG - Intronic
1203078024 16_KI270728v1_random:1132374-1132396 CAGGCATACTCTCCCCACTGAGG - Intergenic
1142710828 17:1723055-1723077 GAGGCAAACTCTCTCCTAAGAGG + Intronic
1143762002 17:9111500-9111522 GAGGCACAGTTCCCCCAGAGAGG + Intronic
1144477966 17:15605244-15605266 GAGGAAAACTTTCTCCTAAGCGG - Exonic
1144702716 17:17349376-17349398 GAGGCCTTCTGTCCACAAAGAGG + Intergenic
1144882184 17:18436026-18436048 GATGCACACTTGCCCCAAGGTGG - Intergenic
1144920331 17:18758462-18758484 GAGGAAAACTTTCTCCTAAGCGG + Exonic
1145150049 17:20508360-20508382 GATGCACACTTGCCCCAAGGTGG + Intergenic
1146156232 17:30526236-30526258 GGGGCATAACTTCCCCTAAGAGG - Exonic
1148431076 17:47644115-47644137 TTGGCATATTTTCCCCAAAATGG - Intergenic
1149369160 17:55976113-55976135 GAGGCATACTTCCTCCTAAATGG - Intergenic
1151781825 17:76251806-76251828 CAGGCAGGCTTTCCCCACAGAGG - Intergenic
1152585704 17:81188563-81188585 GAGGCTTGCTTTCCCCCAGGAGG - Intergenic
1155542702 18:26884585-26884607 GAGACATATTTTCCACAAGGTGG + Intergenic
1157521933 18:48351474-48351496 GTGGTATACTTTCCCCACTGGGG - Intronic
1157649815 18:49316980-49317002 AATGCATAATTTCCCCAAATTGG - Intronic
1157975282 18:52319929-52319951 AATGCAGAATTTCCCCAAAGGGG + Intergenic
1158175162 18:54647822-54647844 GTGTCATACTTTTCTCAAAGTGG - Intergenic
1164296290 19:23913160-23913182 CAGGTCAACTTTCCCCAAAGTGG + Intergenic
1164768618 19:30790742-30790764 GAGGCATGCAGTCCCTAAAGAGG + Intergenic
1166500277 19:43335484-43335506 GGGACAGACTTTTCCCAAAGTGG + Intergenic
1166967243 19:46536510-46536532 GATGCATTCTTACCCCAAAGAGG - Intronic
1167801095 19:51742676-51742698 GAGGGATTTTTTCCCCATAGAGG + Intergenic
925037147 2:696789-696811 GATACAGTCTTTCCCCAAAGCGG - Intergenic
926327381 2:11797025-11797047 GAGGCATGCTACCCCAAAAGAGG + Intronic
929333771 2:40715169-40715191 AAGGCATACTTTCACCCCAGAGG - Intergenic
932166143 2:69509178-69509200 CAGGCAGACTTTGCCCACAGAGG + Intronic
935666793 2:105519111-105519133 GAGGCAGACCTTCCCCAGAGAGG - Intergenic
936283958 2:111166514-111166536 GAGGCATACTTTCTGCACAGAGG - Exonic
936771126 2:115914889-115914911 CAGCCATACTTTCTCCAAAGAGG + Intergenic
938678864 2:133668204-133668226 TATGCATACTTTCCCAGAAGTGG - Intergenic
942119145 2:172759658-172759680 GAGGCATACCATCTCCTAAGAGG - Intronic
946516780 2:220420617-220420639 CAGGCATACTTACTCCATAGGGG - Intergenic
946532784 2:220590402-220590424 GAGTCATTCTTTCCTAAAAGAGG - Intergenic
948111877 2:235462905-235462927 GAAGCCTACTTTTGCCAAAGAGG + Intergenic
948382572 2:237561045-237561067 CAGTCATACTTTCCCCAGGGAGG + Intergenic
1173098040 20:40056191-40056213 CAGGAATAATTTCCCCACAGTGG - Intergenic
1175809667 20:61851268-61851290 GAGGCTGGCTTTACCCAAAGAGG - Intronic
1179490421 21:41737504-41737526 GGGGCAGACTTTTCCTAAAGTGG + Intergenic
1180038504 21:45263628-45263650 GAGGGATTCTTTCCCCAAAGAGG + Intergenic
1180850677 22:19018508-19018530 GAGGCTTCCTGTCACCAAAGAGG - Intergenic
950269266 3:11600722-11600744 GAGGCAGAGTTTCCGCAGAGAGG - Intronic
951968072 3:28410984-28411006 TAGGCAAACTTTCCCAAAATGGG + Intronic
953982636 3:47420303-47420325 GAGCCATCCTCTCCCCAGAGTGG - Intronic
966070882 3:175876694-175876716 GAGATATACTTTACTCAAAGTGG - Intergenic
967280813 3:187821845-187821867 GAGGCATGCTCTCCCCAAGCAGG + Intergenic
968830080 4:2928749-2928771 GAGACATGCTCTCCCCACAGGGG + Exonic
969588604 4:8108727-8108749 GAGCCATCCTTTCCCCTCAGAGG + Intronic
971417143 4:26442198-26442220 GAGGCATTATTTACCCAAGGTGG - Intergenic
974929056 4:68340167-68340189 GATTCAAATTTTCCCCAAAGTGG + Intronic
977498482 4:97806590-97806612 GAGGCATAATTTCCCAGCAGAGG - Intronic
978805944 4:112800629-112800651 GAGGCTGACTTTCTCAAAAGGGG - Intergenic
981451471 4:144902781-144902803 GAGGTATACTTTCACAAAATTGG + Intergenic
982204310 4:152985609-152985631 GTGGCATCATTTCACCAAAGAGG + Intergenic
983580592 4:169306029-169306051 GAGGAATACTTTACACAGAGGGG - Intergenic
983688445 4:170438386-170438408 GAGGGATAATTATCCCAAAGAGG - Intergenic
984376994 4:178944730-178944752 GATTCATCCTTTCTCCAAAGAGG + Intergenic
986038096 5:3960132-3960154 AAGGCTTACTGTCCACAAAGAGG + Intergenic
992426777 5:76665907-76665929 CAGGAAAAGTTTCCCCAAAGAGG + Intronic
995712300 5:115047980-115048002 GAAGCATAAATTCCCCAAATGGG + Intergenic
999193585 5:149766828-149766850 AAAACCTACTTTCCCCAAAGAGG - Intronic
1004512260 6:16292509-16292531 GAGGCCCTCTTTCCCCCAAGCGG + Intronic
1007932649 6:45706439-45706461 AAGGCACACTTTCACCAGAGGGG - Intergenic
1012137160 6:95572616-95572638 GAGAAAAACTTTCACCAAAGGGG + Intergenic
1013604043 6:111731706-111731728 GAGCCATTCTGTCCCCATAGAGG - Intronic
1016470761 6:144371844-144371866 GAGGCATACATTCTGAAAAGAGG + Intronic
1016652060 6:146473384-146473406 GGGGCAATATTTCCCCAAAGAGG + Intergenic
1019645576 7:2127108-2127130 GTGGAAGACTGTCCCCAAAGTGG - Intronic
1020559553 7:9713637-9713659 GAGGAATACTTTCCACACAAAGG + Intergenic
1026179462 7:68026034-68026056 GAGGAATACCTTCACCAAAAGGG + Intergenic
1043491954 8:80758346-80758368 GAAGCACACTTTCCACAAAAAGG + Intronic
1051211702 9:14751740-14751762 GAGGCATACCTTCAAGAAAGAGG - Intronic
1055428227 9:76217631-76217653 GAAGCATGCCTTCCCCCAAGAGG - Intronic
1057076889 9:92142530-92142552 GAGGTCTCCTTTCCCCAGAGCGG - Intergenic
1187197284 X:17099793-17099815 GTGGCATTCCTACCCCAAAGAGG - Intronic
1188530612 X:31136532-31136554 GAGGCATACTGTCACTGAAGTGG - Intronic
1189490777 X:41470186-41470208 GAGGCATAATTTACTCAATGGGG + Intronic
1189521175 X:41769972-41769994 GATGCTTTCTTTCTCCAAAGAGG - Intronic
1190458116 X:50644694-50644716 CAGGCATGATTTCCCCAGAGAGG - Intronic
1192738423 X:73870818-73870840 GAGGCAGACTTTCACCAAGTTGG - Intergenic
1194819415 X:98487805-98487827 GAGTTATACTTTGCCAAAAGAGG + Intergenic
1197238382 X:124094721-124094743 GAAGCTTACTCTCTCCAAAGAGG + Intronic
1200104303 X:153703787-153703809 CAGGCATACTCTCCCCACTGAGG + Intronic
1200303765 X:155005026-155005048 GAGGCATAGTTTCCCTAATTGGG - Intronic