ID: 1065110404

View in Genome Browser
Species Human (GRCh38)
Location 10:22435638-22435660
Sequence TGAGGCATACTTTCCCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110404_1065110412 8 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data
1065110404_1065110415 28 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110404_1065110410 6 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110404_1065110409 5 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data
1065110404_1065110411 7 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110404 Original CRISPR TGAGGCATACTTTCCCCAAA GGG (reversed) Intronic
No off target data available for this crispr