ID: 1065110405

View in Genome Browser
Species Human (GRCh38)
Location 10:22435639-22435661
Sequence GTGAGGCATACTTTCCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110405_1065110411 6 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110405_1065110412 7 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110412 10:22435669-22435691 TAACTCTCCCACTTCTCTGGGGG No data
1065110405_1065110410 5 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110410 10:22435667-22435689 TCTAACTCTCCCACTTCTCTGGG No data
1065110405_1065110415 27 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110405_1065110409 4 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110409 10:22435666-22435688 CTCTAACTCTCCCACTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110405 Original CRISPR GTGAGGCATACTTTCCCCAA AGG (reversed) Intronic
900891754 1:5454639-5454661 ATGGGGCAGGCTTTCCCCAAAGG + Intergenic
902983882 1:20143677-20143699 GGGAGACCTTCTTTCCCCAAAGG + Intronic
903751414 1:25623591-25623613 ATCAGGCATACTTTGCTCAAAGG + Intronic
908691756 1:66788077-66788099 TTGAGCCTTAGTTTCCCCAAAGG + Intergenic
908777060 1:67650418-67650440 GTAAACCCTACTTTCCCCAATGG + Intergenic
908862537 1:68506066-68506088 AGGAGGTATACTTTTCCCAAAGG - Intergenic
910213779 1:84821161-84821183 TAGAGGAATACTTTTCCCAAAGG + Intronic
912005319 1:104891822-104891844 GTGATGTATATTTTCCCCACAGG - Intergenic
923405007 1:233651176-233651198 GTTGGGCACACTTTACCCAATGG - Intronic
924485563 1:244480462-244480484 CGGAGGAATAGTTTCCCCAAGGG - Intronic
1063907574 10:10796968-10796990 GTCATGGATACTTTCCCTAATGG - Intergenic
1064062881 10:12153835-12153857 GTGAGAAATACCTTCCACAACGG - Intronic
1064512884 10:16114265-16114287 GTGAGGCATTCTTTCCCCCTGGG - Intergenic
1064960453 10:20958184-20958206 TTGAGGAATACTGTGCCCAAGGG - Intronic
1065110405 10:22435639-22435661 GTGAGGCATACTTTCCCCAAAGG - Intronic
1066561441 10:36674010-36674032 TTGAGGCACACATTTCCCAAGGG + Intergenic
1066995247 10:42556759-42556781 GTAAGGGCTACATTCCCCAAGGG - Intergenic
1067371754 10:45690455-45690477 GAGAGGCATACTTTCTCACAAGG + Intergenic
1067388027 10:45835694-45835716 GAGAGGCATACTTTCTCACAAGG - Intronic
1067418094 10:46121586-46121608 GAGAGGCATACTTTCTCACAAGG + Intergenic
1067503453 10:46828149-46828171 GAGAGGCATACTTTCTCACAAGG + Intergenic
1067875236 10:50000405-50000427 GAGAGGCATACTTTCTCACAAGG + Intronic
1069535997 10:69253554-69253576 CTGAGGCATGGTTTCCCCATTGG + Intronic
1071283703 10:84125413-84125435 GTGAGGCTCAATTTCCCCACTGG + Intergenic
1072674423 10:97454745-97454767 GTGAGTCATCCTTTCTCGAAAGG - Exonic
1074883160 10:117673925-117673947 GTGATGCTTACTTGCACCAAAGG + Intergenic
1076623237 10:131806337-131806359 GTCAGGCCTACAGTCCCCAATGG - Intergenic
1078613403 11:12841801-12841823 GTGAGCCTCAGTTTCCCCAAAGG - Intronic
1080621319 11:33989535-33989557 GTGATGCAATCTTTCACCAACGG - Intergenic
1081107633 11:39090886-39090908 ATGAGGCATACTTTGCCGCATGG - Intergenic
1081726270 11:45331633-45331655 GTGAAGTATGCTTTCCTCAAAGG + Intergenic
1081793091 11:45802924-45802946 TTGAGTCTTTCTTTCCCCAAAGG + Intergenic
1083162350 11:60862488-60862510 GGGAGACGTACTTTCCCCATGGG + Intergenic
1085668885 11:78442496-78442518 GTGAGGCCTTCTTTTCCTAATGG - Intronic
1087212997 11:95462121-95462143 GAGAGGTGTACTTCCCCCAAAGG - Intergenic
1088277705 11:108105703-108105725 TTGAGCCATTCTTTCCTCAAGGG - Exonic
1090933865 11:131324359-131324381 GTGAGCCATGCGTTCACCAAGGG - Intergenic
1091076295 11:132620760-132620782 GTGAAGCAAACTTACACCAAAGG - Intronic
1091479243 12:809375-809397 GTGAGCCCAACTTTCCTCAATGG - Intronic
1092081726 12:5721980-5722002 TTTACGCATATTTTCCCCAATGG - Intronic
1094134115 12:27106119-27106141 GTCAGGCATTCTTTCCTCCAAGG - Intergenic
1094219008 12:27973839-27973861 GTGAGGCCCACTTTTCCCATGGG - Intergenic
1094691909 12:32777674-32777696 TTGAGGCATTCTTTCCTAAATGG - Intergenic
1100325708 12:93537994-93538016 GTGAGGCTTGCTTTGGCCAATGG + Intergenic
1110404768 13:75137890-75137912 CTGAGGCATTTTTTTCCCAAAGG - Intergenic
1111910368 13:94303885-94303907 GTGAGCCACATTTTTCCCAAAGG + Intronic
1119922805 14:78462033-78462055 GAGAGTAATACTTTCCCCATGGG + Intronic
1122721688 14:103725885-103725907 ATGGGGCTCACTTTCCCCAAGGG - Intronic
1132341811 15:101083674-101083696 GAGTGGCATCCTTTTCCCAAGGG + Intergenic
1135203295 16:20459460-20459482 GTCATGCATATTTTCCCCTATGG + Intronic
1141306450 16:82868682-82868704 GTGAGGCAAATTTAGCCCAAAGG - Intronic
1145847789 17:28057811-28057833 ATGAGCCATTGTTTCCCCAAGGG + Intronic
1149111858 17:53043074-53043096 GTGAGTCATTCTTTTCCCATTGG + Intergenic
1150641791 17:66954236-66954258 GTGGGTCACACTGTCCCCAAAGG - Intergenic
1151823593 17:76511127-76511149 TTGAGGCTTTCTTTCCCCACTGG + Intergenic
1153439571 18:5101660-5101682 GTAAGGCAGACTTTATCCAAGGG + Intergenic
1153826796 18:8882471-8882493 GTGAGGCTCAGTTTCCCCACTGG + Intergenic
1153826804 18:8882513-8882535 GTGAGGCTCAATTTCCCCACTGG + Intergenic
1156135064 18:34027667-34027689 GTAAGTCATATTTTCCCAAATGG + Intronic
1159743101 18:72198038-72198060 ATGAGGCAGACTTATCCCAAAGG + Intergenic
1166590085 19:43989752-43989774 GTGAGGCATCTTTTGCCAAAAGG - Intronic
925472987 2:4182870-4182892 GTGATGCTTCCTTTCCTCAATGG - Intergenic
926672533 2:15589525-15589547 GTGTGACATTTTTTCCCCAAGGG - Intergenic
928608288 2:32964460-32964482 GAAAGGCATTTTTTCCCCAAGGG + Intronic
932904131 2:75731524-75731546 GTGATGAATATTTTCCTCAAAGG + Intergenic
935047772 2:99497613-99497635 GTGAGGCTCAATTTCCCCACTGG - Intergenic
943022848 2:182596378-182596400 ATGAGACATACCTTCCCCCAGGG + Intergenic
944320874 2:198340270-198340292 GTGCGGCATAGTTTTCCCCAGGG + Intronic
947556714 2:231099664-231099686 GTGAGGCTCAATTTCCCCACTGG + Intronic
947556723 2:231099708-231099730 GTGAGGCTCAGTTTCCCCACTGG + Intronic
948467077 2:238157827-238157849 GTAAGGCCTCCTTTCCCCAGCGG + Intergenic
949005676 2:241645808-241645830 GCGAGTCATACATTCCCCTAGGG - Intronic
1168823434 20:792723-792745 GTGAGGCTCAATTTCCCCACTGG - Intergenic
1170163627 20:13341292-13341314 TTGTGGCATACTCTCCCAAATGG - Intergenic
1172610356 20:36246498-36246520 GTGGGGAAAATTTTCCCCAAAGG + Intronic
1177039873 21:16095314-16095336 GTCAGAGATACTTTCCACAAAGG - Intergenic
1180659882 22:17457517-17457539 CTGAGGCATAAGCTCCCCAAGGG + Intronic
1181651601 22:24261968-24261990 GGGAGGCAGACCTGCCCCAAGGG + Intergenic
1203275378 22_KI270734v1_random:82753-82775 GGGAGGCAGACCTGCCCCAAGGG + Intergenic
950846862 3:16023300-16023322 GTGAGGCTCAGTTTCCCCACTGG + Intergenic
952148154 3:30556373-30556395 GTGTGACATACTTTGGCCAATGG - Intergenic
952938931 3:38425383-38425405 GTGATTCATTCTTTCCACAATGG - Intergenic
957235559 3:77584280-77584302 GTGAGGCTTTCTTTCCCTTAGGG - Intronic
963819626 3:149874715-149874737 ATGAAACATACTTTCCACAATGG - Intronic
965642532 3:170845385-170845407 GTGTGGCATTTTTTCCCAAAAGG - Intronic
973292049 4:48480982-48481004 GTGAAGTATTCTTTTCCCAAGGG - Intergenic
975695587 4:77009587-77009609 GTGAGGAATGCTTTCCCCACTGG - Intronic
976091169 4:81459500-81459522 CTGAGGCATACTTTCCTAAAAGG + Exonic
977637456 4:99315947-99315969 ATGAGGCAGACTTTCTCCAGGGG + Exonic
977639854 4:99344911-99344933 ATGAGGCAGACTTTCTCCAGGGG + Exonic
978313751 4:107414084-107414106 GTGAGGCTCAATTTCCTCAATGG - Intergenic
978313764 4:107414141-107414163 GTGAGGCTCAATTTCCCCACTGG - Intergenic
978775808 4:112506064-112506086 GTGAGTGAAACTCTCCCCAAGGG - Intergenic
978805946 4:112800631-112800653 GTGAGGCTGACTTTCTCAAAAGG - Intergenic
979597576 4:122551265-122551287 CTGAGGCATACTTTCCCAATGGG - Intergenic
979668745 4:123340449-123340471 GTGAGTCAGAATTTACCCAATGG - Intergenic
981814442 4:148814255-148814277 CTGAGTCATACTTTCCCAAGTGG + Intergenic
984775415 4:183477697-183477719 GTGGGGGATACTTTCACAAAGGG - Intergenic
985132152 4:186749696-186749718 GTGAGGCAAACTTTGACCAGTGG - Intergenic
986463900 5:8001710-8001732 GTGCGGCATTCCTTCCCCTAGGG + Intergenic
986997857 5:13627807-13627829 GTGAAGCATACTTTGAACAATGG + Intergenic
987767484 5:22251794-22251816 GTAAGTAATACTTTCCCAAAGGG - Intronic
993923413 5:93835900-93835922 TTGAGCCATACTTTTCCCAGTGG - Intronic
999620195 5:153465150-153465172 ATGAGGCCTATTTTCCCAAAGGG + Intergenic
1000360115 5:160439221-160439243 GTAAGACATACTTTCCTAAAAGG - Intergenic
1001299021 5:170520390-170520412 CTGGGGCTTAATTTCCCCAAGGG - Intronic
1001595647 5:172897075-172897097 GTAAGTCATACTTTCCCGATGGG + Intronic
1005390853 6:25331639-25331661 GTGAGGCATCCGTCCCCCAAGGG + Intronic
1005806013 6:29475181-29475203 GTGAGGCATGCTGACCACAATGG + Intergenic
1017427201 6:154334745-154334767 CTGAGCCACAGTTTCCCCAATGG + Intronic
1017427507 6:154337946-154337968 CTGAGCCACAGTTTCCCCAATGG - Intronic
1017598785 6:156058968-156058990 GCAAGCCATGCTTTCCCCAAAGG - Intergenic
1018171541 6:161147093-161147115 TTGAGGCAGACTTTCTGCAAAGG + Intronic
1019077252 6:169397574-169397596 GTTAGTCATCCTTTCCCCAAAGG - Intergenic
1021850993 7:24808481-24808503 GTGATGCATACTTTAAGCAAAGG + Intronic
1023798189 7:43811097-43811119 GTGAGGCTCAATTTCCCCACTGG - Intergenic
1023798658 7:43814325-43814347 GTGAGGCTCAATTTCCCCACTGG - Intergenic
1023798683 7:43814451-43814473 GTGAGGCTTGATTTCCCCACTGG - Intergenic
1024064178 7:45718965-45718987 GTGTGGCATTCATTCCCCAACGG - Exonic
1028333549 7:89625047-89625069 GTGAGGCTCAATTTCCCCACTGG - Intergenic
1030522183 7:110611615-110611637 GTGAAACAAACTTACCCCAAAGG + Intergenic
1033945346 7:146709797-146709819 GAGAGGCATACTGGCCACAAAGG + Intronic
1036957564 8:13205278-13205300 GTTAGTCATATTTTCTCCAATGG - Intronic
1041344334 8:56880490-56880512 GTTAGGCCTACTTCCCCAAATGG + Intergenic
1042088337 8:65132393-65132415 GTGAGGCTCAATTTCCCCACTGG + Intergenic
1042088356 8:65132478-65132500 GTGAGGCTCAATTTCCCCACTGG + Intergenic
1042088363 8:65132520-65132542 GTGAGGCTCAATTTCCCCACTGG + Intergenic
1050159036 9:2697956-2697978 GTCAGGCCTACTCTTCCCAATGG + Intergenic
1055538333 9:77273420-77273442 TTGAGGCATATTTTTCTCAAAGG + Intronic
1059504094 9:114782114-114782136 ATCAGGCATACTGACCCCAAAGG - Intergenic
1188893993 X:35643921-35643943 GTGTGGCATTCCTTCCCCGAGGG + Intergenic
1189490775 X:41470184-41470206 TTGAGGCATAATTTACTCAATGG + Intronic
1189993629 X:46618097-46618119 GTGAGCCACAGTTTCCCTAAAGG + Intronic
1192317935 X:70066667-70066689 GTTAGGCAACCTTTCCCTAAGGG - Intergenic
1192385705 X:70667012-70667034 GTGAGCCAGATTTTGCCCAAAGG - Intronic
1193481604 X:82034933-82034955 CTTAGTCTTACTTTCCCCAAAGG - Intergenic
1194126166 X:90019950-90019972 GTGAGGCACACTATCCATAAAGG - Intergenic
1196090639 X:111737874-111737896 GTGAGGAATACTGTCCTAAAAGG - Intronic
1199637305 X:149825957-149825979 GTGAGGCTCAATTTCCCCACTGG - Intergenic
1200763674 Y:7062696-7062718 TTGAGGCTTAATTTCCCCACTGG + Intronic
1201290539 Y:12417999-12418021 GTGCGGCAGACTTTCAGCAAAGG + Intergenic