ID: 1065110408 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:22435665-22435687 |
Sequence | CAGAGAAGTGGGAGAGTTAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1065110408_1065110417 | 12 | Left | 1065110408 | 10:22435665-22435687 | CCTCTAACTCTCCCACTTCTCTG | No data | ||
Right | 1065110417 | 10:22435700-22435722 | GACCCCTCCCGGCAACTGCTAGG | No data | ||||
1065110408_1065110415 | 1 | Left | 1065110408 | 10:22435665-22435687 | CCTCTAACTCTCCCACTTCTCTG | No data | ||
Right | 1065110415 | 10:22435689-22435711 | GGGCAGCACCTGACCCCTCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1065110408 | Original CRISPR | CAGAGAAGTGGGAGAGTTAG AGG (reversed) | Intronic | ||