ID: 1065110411

View in Genome Browser
Species Human (GRCh38)
Location 10:22435668-22435690
Sequence CTAACTCTCCCACTTCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110398_1065110411 26 Left 1065110398 10:22435619-22435641 CCACTTCATGCTTTCTGCCCCCT 0: 1
1: 0
2: 6
3: 42
4: 448
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110404_1065110411 7 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110403_1065110411 8 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110405_1065110411 6 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data
1065110402_1065110411 9 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110411 10:22435668-22435690 CTAACTCTCCCACTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110411 Original CRISPR CTAACTCTCCCACTTCTCTG GGG Intronic
No off target data available for this crispr