ID: 1065110415

View in Genome Browser
Species Human (GRCh38)
Location 10:22435689-22435711
Sequence GGGCAGCACCTGACCCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110408_1065110415 1 Left 1065110408 10:22435665-22435687 CCTCTAACTCTCCCACTTCTCTG 0: 1
1: 0
2: 1
3: 46
4: 450
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110402_1065110415 30 Left 1065110402 10:22435636-22435658 CCCCCTTTGGGGAAAGTATGCCT 0: 1
1: 0
2: 1
3: 7
4: 125
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110413_1065110415 -10 Left 1065110413 10:22435676-22435698 CCCACTTCTCTGGGGGCAGCACC 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110405_1065110415 27 Left 1065110405 10:22435639-22435661 CCTTTGGGGAAAGTATGCCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110403_1065110415 29 Left 1065110403 10:22435637-22435659 CCCCTTTGGGGAAAGTATGCCTC 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110404_1065110415 28 Left 1065110404 10:22435638-22435660 CCCTTTGGGGAAAGTATGCCTCA No data
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data
1065110407_1065110415 10 Left 1065110407 10:22435656-22435678 CCTCACGGACCTCTAACTCTCCC 0: 1
1: 0
2: 0
3: 4
4: 146
Right 1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110415 Original CRISPR GGGCAGCACCTGACCCCTCC CGG Intronic
No off target data available for this crispr