ID: 1065110748

View in Genome Browser
Species Human (GRCh38)
Location 10:22437487-22437509
Sequence CGCCTCCCGCGGAAAGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065110748_1065110758 22 Left 1065110748 10:22437487-22437509 CCGCCCGCTTTCCGCGGGAGGCG No data
Right 1065110758 10:22437532-22437554 TCTCCGCCTCAGCGAAAGAAAGG No data
1065110748_1065110755 -6 Left 1065110748 10:22437487-22437509 CCGCCCGCTTTCCGCGGGAGGCG No data
Right 1065110755 10:22437504-22437526 GAGGCGCGCCGGGCACCGCTGGG No data
1065110748_1065110754 -7 Left 1065110748 10:22437487-22437509 CCGCCCGCTTTCCGCGGGAGGCG No data
Right 1065110754 10:22437503-22437525 GGAGGCGCGCCGGGCACCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065110748 Original CRISPR CGCCTCCCGCGGAAAGCGGG CGG (reversed) Intronic