ID: 1065112303

View in Genome Browser
Species Human (GRCh38)
Location 10:22452273-22452295
Sequence AGATTTACCCTTCAACTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112303_1065112306 17 Left 1065112303 10:22452273-22452295 CCACCAAGTTGAAGGGTAAATCT 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1065112306 10:22452313-22452335 TATTTCTTTCCACCTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112303 Original CRISPR AGATTTACCCTTCAACTTGG TGG (reversed) Intronic
902976177 1:20090222-20090244 AGATTTAGCCTTGAACTCAGAGG - Intronic
909869121 1:80717308-80717330 TGATTTACTTTTTAACTTGGAGG - Intergenic
910275487 1:85445119-85445141 AGATTCACCCTTAATCTGGGTGG - Intronic
910938310 1:92505165-92505187 AGAGGTTACCTTCAACTTGGGGG - Intergenic
911375145 1:97043443-97043465 ATGTTTTCTCTTCAACTTGGTGG + Intergenic
912129604 1:106585545-106585567 AGATGTACCCTTAATCTTGGTGG - Intergenic
913648502 1:120886199-120886221 AAATTTACCCTTTAATTTTGGGG + Intergenic
914078191 1:144377162-144377184 AAATTTACCCTTTAATTTTGGGG - Intergenic
914100988 1:144589339-144589361 AAATTTACCCTTTAATTTTGGGG + Intergenic
914173099 1:145245696-145245718 AAATTTACCCTTTAATTTTGGGG - Intergenic
914297991 1:146348316-146348338 AAATTTACCCTTTAATTTTGGGG - Intergenic
914527754 1:148486835-148486857 AAATTTACCCTTTAATTTTGGGG - Intergenic
914638636 1:149580230-149580252 AAATTTACCCTTTAATTTTGGGG + Intergenic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
920000821 1:202797320-202797342 AGATTTGGTCTTGAACTTGGAGG - Intronic
923380503 1:233412987-233413009 AGACTTACCCTTAATCTGGGAGG + Intergenic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1066326477 10:34364874-34364896 AGATTGAACCTTGTACTTGGAGG - Intronic
1068005564 10:51389565-51389587 ACTTTCACCCTTCTACTTGGTGG + Intronic
1068471287 10:57467092-57467114 TGATTTAACCTTCATCATGGAGG + Intergenic
1069803454 10:71099537-71099559 AGATCTACCCTTCATCTGGTGGG + Intergenic
1070695280 10:78558601-78558623 AGTTTTTCCCTTTAACTCGGAGG + Intergenic
1071811992 10:89192290-89192312 AGATTCACCCTTAATCTGGGTGG + Intergenic
1072337799 10:94415071-94415093 AGATTTACCCTGGTACTTGTAGG - Intronic
1074136678 10:110633600-110633622 AGATTTACCTTTTACTTTGGAGG + Intergenic
1074802359 10:117013728-117013750 ACATTTGCCATACAACTTGGTGG + Intronic
1076711361 10:132336998-132337020 AGATTGACACATCAACTCGGTGG - Intronic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1081027077 11:38028783-38028805 TGATTAACCGTCCAACTTGGTGG + Intergenic
1081918562 11:46750806-46750828 AGATTTCCACCTCAACTTGATGG + Intronic
1082906136 11:58310367-58310389 AGATTTACCCTACACCCTGTAGG + Intergenic
1085424391 11:76391066-76391088 GGAATTACCCTACAACGTGGTGG + Intronic
1085999373 11:81962233-81962255 AGATTTACCATTAATATTGGGGG - Intergenic
1091351137 11:134895675-134895697 TGATTTATCCTTCAACTTACAGG + Intergenic
1093527344 12:20117126-20117148 AGATTCACCCTTAATCTGGGTGG - Intergenic
1093818872 12:23586282-23586304 AGAATTAACCTACCACTTGGGGG - Intronic
1094787323 12:33863672-33863694 AGACTTACCCTTCAGGGTGGTGG + Intergenic
1098063554 12:66587885-66587907 AGATTTCCCCTTCAAAATGTGGG - Intronic
1098766166 12:74491987-74492009 AGATTTACCCTTCAACTTATTGG - Intergenic
1099116335 12:78629534-78629556 AGATTTACTATACAACTTGGTGG + Intergenic
1099577649 12:84401926-84401948 AGAAATACCCTTAATCTTGGTGG + Intergenic
1105439624 13:20404509-20404531 ATCTTTACCCTTGATCTTGGTGG - Intronic
1106204440 13:27577349-27577371 AAATTCACACTTTAACTTGGAGG - Intronic
1110597588 13:77336208-77336230 TAATTTACCCTTTAACTTGTAGG - Intergenic
1110742521 13:79014635-79014657 AGATCTACCCTTAATCTTGTGGG + Intergenic
1111386585 13:87536476-87536498 GGACTGACCCTTCAACTTGTGGG + Intergenic
1112189936 13:97166515-97166537 AGATTCACCCTTAATCTGGGTGG + Intergenic
1120594385 14:86415954-86415976 AGATCCACCCTTAAACTGGGTGG - Intergenic
1123183184 14:106489088-106489110 AGATGTACCTTTCATTTTGGAGG - Intergenic
1123408953 15:20042848-20042870 AGACCTACCCTTAATCTTGGTGG + Intergenic
1123518283 15:21049558-21049580 AGACCTACCCTTAATCTTGGTGG + Intergenic
1126791264 15:52223219-52223241 AGAGCTACCCTTCAATTTTGTGG + Intronic
1127646112 15:60961072-60961094 AGATTTGCCCTTGACCTTGATGG - Intronic
1127872682 15:63086590-63086612 ACATTTACCAATAAACTTGGGGG - Intergenic
1131713368 15:95080341-95080363 ATATTTCTCATTCAACTTGGGGG + Intergenic
1137511023 16:49100924-49100946 AGATTTCCCCTTCAAGATGAAGG - Intergenic
1137831740 16:51550273-51550295 AGATTGACCATTCAAGCTGGGGG - Intergenic
1139041467 16:63004034-63004056 AGATCCACCCTTAAACTGGGTGG - Intergenic
1139271176 16:65684223-65684245 AAATTTACCTTTCAACTTGAAGG - Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1146460458 17:33042004-33042026 TGATTTGCCCTCCAACTGGGTGG - Intronic
1146643288 17:34557047-34557069 ATATTTACCCTCCAGCCTGGTGG - Intergenic
1147691222 17:42315948-42315970 AGATTTACCCTCCTCCCTGGAGG + Intronic
1147761806 17:42803056-42803078 AGATTTACCCAGCAAACTGGTGG + Intronic
1147988482 17:44319758-44319780 AGATTTGGTCTTGAACTTGGGGG + Exonic
1149083041 17:52680876-52680898 AGCTTTCCCCTTCAGCTCGGTGG - Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155318051 18:24591802-24591824 AGAATCACCCTTAATCTTGGTGG + Intergenic
1155915863 18:31556725-31556747 CCCTTTCCCCTTCAACTTGGAGG - Intergenic
1159503631 18:69306330-69306352 AAATTTACCCTACAACTTAGTGG + Intergenic
1161209701 19:3060033-3060055 AGATTCCCCTTTCTACTTGGAGG + Intronic
1165529646 19:36387306-36387328 AGTTTTTCCCTAAAACTTGGGGG - Intronic
934172635 2:89553306-89553328 AGAATTACCCTTCCATTTGTGGG - Intergenic
934282948 2:91627658-91627680 AGAATTACCCTTCCATTTGTGGG - Intergenic
943734547 2:191339987-191340009 AGAGAGACCCTCCAACTTGGAGG + Intronic
947687102 2:232097624-232097646 GGACTTACCCTTCAAAGTGGTGG + Intronic
1170083383 20:12501717-12501739 AGATTTTTCCTTCAACTTGAAGG - Intergenic
1175229693 20:57465882-57465904 AGATTTTCCCTGCATCTTTGTGG + Intergenic
1179105170 21:38393619-38393641 AGATTGACCCATCAAATTGCTGG - Intronic
1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG + Intergenic
952917696 3:38261593-38261615 AGACCTAGCCTTCAACTTGTGGG + Intergenic
953717202 3:45325891-45325913 AGCTTTGAGCTTCAACTTGGTGG - Intergenic
953779857 3:45858358-45858380 AGATCTTCCCTTGACCTTGGAGG - Intronic
954858779 3:53669940-53669962 AATTTTTCCCTTCAACTTAGAGG + Intronic
958679391 3:97306915-97306937 AGACTTATCCTTCAGCTTTGAGG + Intronic
959907458 3:111725749-111725771 ATATTTACCCTTATATTTGGGGG + Intronic
962457131 3:135574892-135574914 GTCTTCACCCTTCAACTTGGGGG + Intergenic
963717264 3:148817800-148817822 AGAATTACCCTGTAACTTGATGG - Intronic
966631852 3:182084910-182084932 AGATTTAATCTCCTACTTGGTGG + Intergenic
971486113 4:27162250-27162272 AGATTTACCCTTGGAGTTGCTGG - Intergenic
971979789 4:33736778-33736800 AGATTCACCCTTAATCTGGGTGG - Intergenic
975716341 4:77209021-77209043 AGAGTTCCCCTAGAACTTGGAGG + Intronic
978508730 4:109491825-109491847 AGATGCTACCTTCAACTTGGGGG + Intronic
978833555 4:113118426-113118448 ATGTTTACCTTTCAATTTGGGGG + Intronic
979370551 4:119881028-119881050 AGTTTTAACCTTCAACTTTATGG - Intergenic
979580527 4:122353549-122353571 AGCTTTACTTTTCTACTTGGTGG + Intronic
980245793 4:130239897-130239919 AGATTTACTCTTCACCAAGGAGG + Intergenic
981873492 4:149514793-149514815 AGATTCACCCTTAATCTGGGTGG + Intergenic
983325136 4:166244659-166244681 AGACTTACCCTCAAACTGGGTGG - Intergenic
983953229 4:173666971-173666993 AGGTTTTCCCTTCCACTTGATGG + Intergenic
984180128 4:176472409-176472431 AGACCTACCCTTCATCTGGGTGG - Intergenic
986039242 5:3971659-3971681 AGACCTACCCTTAAACTGGGTGG - Intergenic
987505843 5:18770695-18770717 AGATTTTCCTTTCATTTTGGAGG - Intergenic
988957879 5:36337259-36337281 AGATGTACCCTTGAGCTTTGCGG - Intergenic
989979765 5:50629592-50629614 AAATTTACCCTTTAATTTTGGGG + Intergenic
989990453 5:50757882-50757904 GGATCTTCCCTTCTACTTGGTGG + Intronic
991487221 5:67149886-67149908 AAATTTATCATTTAACTTGGAGG - Intronic
993195586 5:84740601-84740623 AGGTTTAACCTTTAACTTGGTGG - Intergenic
995931989 5:117456528-117456550 AGATTTACCTTTCTTCTTAGTGG + Intergenic
998177205 5:139909206-139909228 ACATTTTCCCTTCCACTTTGAGG + Intronic
1000382809 5:160644394-160644416 AGATCTACCCTTGAACATGAAGG - Intronic
1003299116 6:4860895-4860917 AGATCTACCCTTCATCTGGTGGG - Intronic
1004729968 6:18348020-18348042 AGAAGTACCTTTCAATTTGGTGG - Intergenic
1008475474 6:51931479-51931501 AGATTTCCCCTCCAGCGTGGTGG - Intronic
1010937881 6:81883460-81883482 AGACCTACCCTTCATCTGGGTGG - Intergenic
1011039040 6:83010837-83010859 AGATCTACCCTTAATCTGGGTGG - Intronic
1011391111 6:86854726-86854748 AGATGGAGCCTTCAACTTGGGGG - Intergenic
1013720389 6:113019253-113019275 AGTTTTAATCTTCCACTTGGAGG + Intergenic
1014544535 6:122717923-122717945 AGATTTGCCCCTCAAACTGGAGG + Exonic
1015322662 6:131893815-131893837 AAATTTACCATTCAAACTGGGGG - Exonic
1016096188 6:140040680-140040702 AGATTTACTCATGAACCTGGTGG - Intergenic
1016721865 6:147307573-147307595 ATATTTACTCTTCAAGTTTGAGG + Intronic
1019457292 7:1137049-1137071 AGCTGTCCCCTTCCACTTGGAGG + Intronic
1022260774 7:28702783-28702805 AGATTTGGCCTTTAATTTGGGGG + Intronic
1024271457 7:47645430-47645452 AGTTTTATCTTTCAACCTGGAGG - Intergenic
1037675418 8:21046727-21046749 AGATTCACCCTCAATCTTGGTGG - Intergenic
1038317739 8:26502028-26502050 AAATTTTCCCTTCAAGTGGGAGG + Intronic
1041369923 8:57148535-57148557 AGAAATACCCTTGAATTTGGTGG - Intergenic
1046463430 8:114571354-114571376 AGACCTACCCTTCAGCTGGGTGG + Intergenic
1047590900 8:126325760-126325782 AGAGTTACACTTGGACTTGGTGG + Intergenic
1050949790 9:11573868-11573890 ATATTTACACATCAACTTAGAGG + Intergenic
1058543861 9:106040280-106040302 AGATTCACCCTTAATCTGGGTGG - Intergenic
1185610475 X:1391500-1391522 AGAATTACCCTTCACGGTGGAGG + Intronic
1190578536 X:51867571-51867593 AGATATACCCTTCAACTGGTGGG - Intronic
1192805307 X:74503484-74503506 AGATTAACCCTTGACCTTGCTGG + Intronic
1196039627 X:111188218-111188240 AGCTTTACCTTTCAAATTCGTGG - Intronic
1196788571 X:119443690-119443712 AGTTTCACCCTTCAACTTGATGG + Intronic
1196849940 X:119927717-119927739 AGATTTCCCCTACAAATAGGAGG - Intronic
1197037599 X:121895305-121895327 AGACCTACCCTTAATCTTGGTGG + Intergenic