ID: 1065112666

View in Genome Browser
Species Human (GRCh38)
Location 10:22455267-22455289
Sequence GAACCCAGGGCTGAGGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112666_1065112674 -2 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112674 10:22455288-22455310 TCTACTGGATGTGCCGGCCAGGG No data
1065112666_1065112678 18 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112678 10:22455308-22455330 GGGGCCACCTCTACTTCTGCTGG No data
1065112666_1065112679 19 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112666_1065112680 20 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112680 10:22455310-22455332 GGCCACCTCTACTTCTGCTGGGG No data
1065112666_1065112672 -8 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112672 10:22455282-22455304 CTGGGTTCTACTGGATGTGCCGG No data
1065112666_1065112675 -1 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112675 10:22455289-22455311 CTACTGGATGTGCCGGCCAGGGG No data
1065112666_1065112673 -3 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112666 Original CRISPR GAACCCAGGGCTGAGGTTGG TGG (reversed) Intergenic