ID: 1065112667

View in Genome Browser
Species Human (GRCh38)
Location 10:22455270-22455292
Sequence GTAGAACCCAGGGCTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112667_1065112680 17 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112680 10:22455310-22455332 GGCCACCTCTACTTCTGCTGGGG No data
1065112667_1065112679 16 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112667_1065112674 -5 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112674 10:22455288-22455310 TCTACTGGATGTGCCGGCCAGGG No data
1065112667_1065112673 -6 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112673 10:22455287-22455309 TTCTACTGGATGTGCCGGCCAGG No data
1065112667_1065112678 15 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112678 10:22455308-22455330 GGGGCCACCTCTACTTCTGCTGG No data
1065112667_1065112675 -4 Left 1065112667 10:22455270-22455292 CCAACCTCAGCCCTGGGTTCTAC No data
Right 1065112675 10:22455289-22455311 CTACTGGATGTGCCGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112667 Original CRISPR GTAGAACCCAGGGCTGAGGT TGG (reversed) Intergenic