ID: 1065112670

View in Genome Browser
Species Human (GRCh38)
Location 10:22455280-22455302
Sequence GGCACATCCAGTAGAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112670_1065112680 7 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112680 10:22455310-22455332 GGCCACCTCTACTTCTGCTGGGG No data
1065112670_1065112679 6 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112670_1065112683 21 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112670_1065112678 5 Left 1065112670 10:22455280-22455302 CCCTGGGTTCTACTGGATGTGCC No data
Right 1065112678 10:22455308-22455330 GGGGCCACCTCTACTTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112670 Original CRISPR GGCACATCCAGTAGAACCCA GGG (reversed) Intergenic