ID: 1065112671

View in Genome Browser
Species Human (GRCh38)
Location 10:22455281-22455303
Sequence CGGCACATCCAGTAGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112671_1065112679 5 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112679 10:22455309-22455331 GGGCCACCTCTACTTCTGCTGGG No data
1065112671_1065112683 20 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112683 10:22455324-22455346 CTGCTGGGGCCTCCCAATGCTGG No data
1065112671_1065112678 4 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112678 10:22455308-22455330 GGGGCCACCTCTACTTCTGCTGG No data
1065112671_1065112680 6 Left 1065112671 10:22455281-22455303 CCTGGGTTCTACTGGATGTGCCG No data
Right 1065112680 10:22455310-22455332 GGCCACCTCTACTTCTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112671 Original CRISPR CGGCACATCCAGTAGAACCC AGG (reversed) Intergenic