ID: 1065112672

View in Genome Browser
Species Human (GRCh38)
Location 10:22455282-22455304
Sequence CTGGGTTCTACTGGATGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1065112661_1065112672 23 Left 1065112661 10:22455236-22455258 CCTTCTATGTAGCTAGAACTACA No data
Right 1065112672 10:22455282-22455304 CTGGGTTCTACTGGATGTGCCGG No data
1065112666_1065112672 -8 Left 1065112666 10:22455267-22455289 CCACCAACCTCAGCCCTGGGTTC No data
Right 1065112672 10:22455282-22455304 CTGGGTTCTACTGGATGTGCCGG No data
1065112664_1065112672 -5 Left 1065112664 10:22455264-22455286 CCACCACCAACCTCAGCCCTGGG No data
Right 1065112672 10:22455282-22455304 CTGGGTTCTACTGGATGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1065112672 Original CRISPR CTGGGTTCTACTGGATGTGC CGG Intergenic