ID: 1065112672 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:22455282-22455304 |
| Sequence | CTGGGTTCTACTGGATGTGC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1065112661_1065112672 | 23 | Left | 1065112661 | 10:22455236-22455258 | CCTTCTATGTAGCTAGAACTACA | No data | ||
| Right | 1065112672 | 10:22455282-22455304 | CTGGGTTCTACTGGATGTGCCGG | No data | ||||
| 1065112666_1065112672 | -8 | Left | 1065112666 | 10:22455267-22455289 | CCACCAACCTCAGCCCTGGGTTC | No data | ||
| Right | 1065112672 | 10:22455282-22455304 | CTGGGTTCTACTGGATGTGCCGG | No data | ||||
| 1065112664_1065112672 | -5 | Left | 1065112664 | 10:22455264-22455286 | CCACCACCAACCTCAGCCCTGGG | No data | ||
| Right | 1065112672 | 10:22455282-22455304 | CTGGGTTCTACTGGATGTGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1065112672 | Original CRISPR | CTGGGTTCTACTGGATGTGC CGG | Intergenic | ||